Mutagenetix > Incidental Mutation

Incidental Mutation 'R1563:Slc8a3'

170775

Institutional Source

Beutler Lab

Gene Symbol

Slc8a3

Ensembl Gene

ENSMUSG00000079055

Gene Name

solute carrier family 8 (sodium/calcium exchanger), member 3

Synonyms

Ncx3

MMRRC Submission

039602-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1563 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

81197915-81333180 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 81205007 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Valine at position 640 (D640V)

Ref Sequence

ENSEMBL: ENSMUSP00000138735 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000064594] [ENSMUST00000085238] [ENSMUST00000182208] [ENSMUST00000182366]

AlphaFold

S4R2P9

Predicted Effect

probably benign
Transcript: ENSMUST00000064594
AA Change: D639V

PolyPhen 2 Score 0.248 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000063258
Gene: ENSMUSG00000079055
AA Change: D639V

Domain	Start	End	E-Value	Type
signal peptide	1	32	N/A	INTRINSIC
Pfam:Na_Ca_ex	79	250	1.3e-36	PFAM
Pfam:Na_Ca_ex_C	253	379	4.6e-57	PFAM
Calx_beta	385	485	3.25e-42	SMART
Calx_beta	519	619	1.04e-40	SMART
low complexity region	712	723	N/A	INTRINSIC
Pfam:Na_Ca_ex	754	919	2e-27	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000085238
AA Change: D633V

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)

SMART Domains

Protein: ENSMUSP00000082334
Gene: ENSMUSG00000079055
AA Change: D633V

Domain	Start	End	E-Value	Type
signal peptide	1	32	N/A	INTRINSIC
Pfam:Na_Ca_ex	79	250	1.3e-36	PFAM
Pfam:Na_Ca_ex_C	253	379	4.6e-57	PFAM
Calx_beta	385	485	3.25e-42	SMART
Calx_beta	519	619	1.54e-43	SMART
low complexity region	705	716	N/A	INTRINSIC
Pfam:Na_Ca_ex	747	912	1.9e-27	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000182208
AA Change: D640V

PolyPhen 2 Score 0.467 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000138735
Gene: ENSMUSG00000079055
AA Change: D640V

Domain	Start	End	E-Value	Type
signal peptide	1	32	N/A	INTRINSIC
Pfam:Na_Ca_ex	89	248	8.1e-38	PFAM
Calx_beta	385	485	3.25e-42	SMART
Calx_beta	519	619	1.04e-40	SMART
low complexity region	712	723	N/A	INTRINSIC
Pfam:Na_Ca_ex	764	917	9.1e-27	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000182366
AA Change: D10V

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000138803
Gene: ENSMUSG00000079055
AA Change: D10V

Domain	Start	End	E-Value	Type
PDB:2LT9\|A	1	52	2e-28	PDB
low complexity region	82	93	N/A	INTRINSIC

Meta Mutation Damage Score

0.2009

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.2%
20x: 92.4%

Validation Efficiency

98% (82/84)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the sodium/calcium exchanger integral membrane protein family. Na+/Ca2+ exchange proteins are involved in maintaining Ca2+ homeostasis in a wide variety of cell types. The protein is regulated by intracellular calcium ions and is found in both the plasma membrane and intracellular organellar membranes, where exchange of Na+ for Ca2+ occurs in an electrogenic manner. Alternative splicing has been observed for this gene and multiple variants have been described. [provided by RefSeq, Aug 2013]
PHENOTYPE: Mice homozygous for disruptions in this gene display a normal phenotype. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 79 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310035C23Rik	A	G	1: 105,719,534	Y707C	probably damaging	Het
4930519G04Rik	T	C	5: 114,863,508	M22T	probably benign	Het
A930018M24Rik	A	G	14: 50,897,119	L22P	probably damaging	Het
Aipl1	A	T	11: 72,036,712	M59K	probably damaging	Het
Atg2b	T	C	12: 105,623,488	I1835V	probably damaging	Het
Cacna1i	T	C	15: 80,321,188	V115A	probably damaging	Het
Cacna1i	A	T	15: 80,389,855		probably benign	Het
Catsperb	T	A	12: 101,588,102	M685K	probably damaging	Het
Cdh10	T	A	15: 18,986,767	Y361*	probably null	Het
Clcn4	C	T	7: 7,293,982	C219Y	probably damaging	Het
Cpeb2	G	A	5: 43,285,737	V924M	probably damaging	Het
Cpxm2	T	C	7: 132,143,682	E138G	probably benign	Het
Dennd1a	T	C	2: 37,858,429	Y346C	probably damaging	Het
Dnah8	T	A	17: 30,635,664	L100Q	probably benign	Het
Dnajc6	A	C	4: 101,599,137	N76T	probably damaging	Het
Ehbp1	A	G	11: 22,059,231	L954P	probably damaging	Het
Eral1	A	T	11: 78,075,406	D315E	probably benign	Het
Fam129a	A	T	1: 151,715,673	Y522F	possibly damaging	Het
Fbln2	G	T	6: 91,263,383	E724*	probably null	Het
Fyco1	A	G	9: 123,827,182		probably benign	Het
Fzd3	T	A	14: 65,235,724	E198D	probably damaging	Het
Fzd9	T	C	5: 135,250,554	N159S	probably damaging	Het
Galnt6	T	A	15: 100,703,378	Q340L	probably benign	Het
Gm20939	C	T	17: 94,877,094	A390V	probably damaging	Het
Gm5435	T	G	12: 82,495,690		noncoding transcript	Het
Gm9949	A	C	18: 62,184,018		probably benign	Het
Gprc5b	G	A	7: 118,983,761	T295I	probably benign	Het
Gria2	G	T	3: 80,691,397	Q777K	probably damaging	Het
Gtf3c3	C	T	1: 54,417,778	A488T	probably damaging	Het
Haao	T	C	17: 83,834,889	T174A	probably benign	Het
Hes6	A	T	1: 91,413,136	M1K	probably null	Het
Hook3	G	T	8: 26,110,752	Q43K	probably benign	Het
Klhl35	T	C	7: 99,471,695	V390A	probably damaging	Het
Myh9	G	T	15: 77,771,857	T1151K	probably damaging	Het
Nbn	A	T	4: 15,981,668	I587F	possibly damaging	Het
Nek4	A	G	14: 30,982,451	D696G	probably damaging	Het
Nlrp2	T	C	7: 5,308,725	D52G	probably damaging	Het
Oit3	G	T	10: 59,428,074	R413S	probably damaging	Het
Olfr1298	T	A	2: 111,645,682	H105L	probably damaging	Het
Olfr786	A	G	10: 129,437,711	M300V	probably benign	Het
Otof	T	C	5: 30,371,005	T1870A	probably benign	Het
Pdgfd	T	C	9: 6,293,939		probably null	Het
Pitrm1	T	C	13: 6,563,470	V526A	possibly damaging	Het
Pknox1	T	C	17: 31,595,282	S194P	probably damaging	Het
Plekhg5	T	C	4: 152,096,809	S8P	probably benign	Het
Ppp1r13b	T	C	12: 111,840,982	E157G	probably damaging	Het
Psmd3	C	T	11: 98,694,225	R466W	probably damaging	Het
Ptgfrn	A	G	3: 101,060,651	F542S	possibly damaging	Het
Ptgs1	A	T	2: 36,245,202	M393L	possibly damaging	Het
Qpct	T	A	17: 79,064,063	S87T	probably benign	Het
Qtrt1	T	A	9: 21,419,311	V269D	probably benign	Het
Rassf9	C	G	10: 102,544,960	R68G	probably damaging	Het
Rif1	A	G	2: 52,073,223	E25G	probably damaging	Het
Rnf213	T	C	11: 119,414,526	F528L	probably benign	Het
Sgip1	T	C	4: 102,966,260	S693P	probably benign	Het
She	A	G	3: 89,854,614	D460G	probably benign	Het
Sipa1l1	G	T	12: 82,341,161	V54L	probably benign	Het
Smurf1	T	A	5: 144,882,513	E601D	probably damaging	Het
Sned1	G	A	1: 93,281,654	V830M	possibly damaging	Het
Synpo2l	A	G	14: 20,661,278	S425P	probably damaging	Het
Tbck	T	C	3: 132,715,693	V187A	possibly damaging	Het
Tcf23	A	T	5: 30,968,831	H18L	probably benign	Het
Tcp11l2	A	G	10: 84,584,944	S16G	probably damaging	Het
Tekt2	T	A	4: 126,323,407	M233L	probably benign	Het
Tex14	T	C	11: 87,536,808	S29P	probably damaging	Het
Tjp2	T	A	19: 24,132,703	N59I	probably damaging	Het
Tlr5	G	A	1: 182,975,010	M626I	probably benign	Het
Tnn	A	T	1: 160,125,415	V685D	probably damaging	Het
Trappc9	G	A	15: 73,025,967	R377W	probably damaging	Het
Trhr	G	A	15: 44,197,101	V6I	probably benign	Het
Trim30c	C	T	7: 104,382,951	R301Q	probably benign	Het
Usp51	T	C	X: 153,007,992	I194T	probably benign	Het
Vmn2r63	A	G	7: 42,904,126	S569P	probably benign	Het
Vps26a	T	G	10: 62,464,680	I236L	probably benign	Het
Zc3h7b	C	T	15: 81,777,088	P376L	probably benign	Het
Zcchc14	T	C	8: 121,603,979	M882V	probably benign	Het
Zfhx2	A	G	14: 55,065,088	V1813A	probably benign	Het
Zswim2	C	T	2: 83,915,282	G604D	possibly damaging	Het
Zzef1	C	T	11: 72,848,733	Q669*	probably null	Het

Other mutations in Slc8a3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00164:Slc8a3	APN	12	81314569	missense	probably benign
IGL01315:Slc8a3	APN	12	81314395	missense	probably damaging	0.97
IGL01365:Slc8a3	APN	12	81315376	missense	probably damaging	0.99
IGL01610:Slc8a3	APN	12	81315802	missense	probably damaging	1.00
IGL02227:Slc8a3	APN	12	81315683	missense	probably damaging	1.00
IGL02299:Slc8a3	APN	12	81315224	missense	probably damaging	0.98
IGL02548:Slc8a3	APN	12	81204156	splice site	probably benign
IGL02646:Slc8a3	APN	12	81315094	missense	probably damaging	1.00
IGL03135:Slc8a3	APN	12	81202249	missense	probably damaging	1.00
R0050:Slc8a3	UTSW	12	81315265	missense	probably damaging	1.00
R0627:Slc8a3	UTSW	12	81314842	missense	probably damaging	1.00
R0648:Slc8a3	UTSW	12	81314446	missense	probably damaging	1.00
R1342:Slc8a3	UTSW	12	81316016	missense	probably damaging	0.99
R1437:Slc8a3	UTSW	12	81315986	missense	probably damaging	0.99
R1470:Slc8a3	UTSW	12	81199710	missense	probably benign
R1470:Slc8a3	UTSW	12	81199710	missense	probably benign
R1557:Slc8a3	UTSW	12	81315557	missense	probably damaging	1.00
R1918:Slc8a3	UTSW	12	81314844	missense	probably damaging	0.99
R1930:Slc8a3	UTSW	12	81314446	missense	probably damaging	1.00
R1931:Slc8a3	UTSW	12	81314446	missense	probably damaging	1.00
R2232:Slc8a3	UTSW	12	81315220	missense	probably damaging	0.99
R2680:Slc8a3	UTSW	12	81202339	missense	probably damaging	0.99
R2941:Slc8a3	UTSW	12	81315179	missense	probably damaging	1.00
R3157:Slc8a3	UTSW	12	81314992	missense	probably damaging	1.00
R3159:Slc8a3	UTSW	12	81314992	missense	probably damaging	1.00
R3751:Slc8a3	UTSW	12	81204138	missense	probably damaging	1.00
R3859:Slc8a3	UTSW	12	81314872	missense	probably damaging	0.99
R4240:Slc8a3	UTSW	12	81315176	missense	probably damaging	0.99
R4527:Slc8a3	UTSW	12	81315853	missense	probably damaging	1.00
R4547:Slc8a3	UTSW	12	81314851	missense	possibly damaging	0.76
R4951:Slc8a3	UTSW	12	81314699	missense	probably benign	0.31
R4951:Slc8a3	UTSW	12	81315986	missense	probably damaging	0.99
R5022:Slc8a3	UTSW	12	81199558	missense	probably damaging	0.96
R5049:Slc8a3	UTSW	12	81214132	missense	probably damaging	1.00
R5057:Slc8a3	UTSW	12	81199558	missense	probably damaging	0.96
R5104:Slc8a3	UTSW	12	81214134	missense	probably null	0.34
R5122:Slc8a3	UTSW	12	81314258	critical splice donor site	probably null
R5183:Slc8a3	UTSW	12	81314491	missense	possibly damaging	0.79
R5629:Slc8a3	UTSW	12	81199631	missense	probably damaging	1.00
R6062:Slc8a3	UTSW	12	81314350	missense	probably damaging	1.00
R6218:Slc8a3	UTSW	12	81199567	missense	probably benign
R6279:Slc8a3	UTSW	12	81314978	missense	probably damaging	0.99
R6300:Slc8a3	UTSW	12	81314978	missense	probably damaging	0.99
R6416:Slc8a3	UTSW	12	81315627	missense	probably damaging	1.00
R6790:Slc8a3	UTSW	12	81314432	missense	probably benign	0.00
R6999:Slc8a3	UTSW	12	81314755	missense	probably benign	0.06
R7195:Slc8a3	UTSW	12	81314273	missense	possibly damaging	0.95
R7268:Slc8a3	UTSW	12	81315053	missense	probably damaging	0.98
R7288:Slc8a3	UTSW	12	81216824	missense	possibly damaging	0.70
R7383:Slc8a3	UTSW	12	81315805	missense	probably damaging	1.00
R7392:Slc8a3	UTSW	12	81314803	missense	probably damaging	0.99
R7394:Slc8a3	UTSW	12	81214058	splice site	probably null
R7549:Slc8a3	UTSW	12	81314770	missense	probably benign	0.06
R7657:Slc8a3	UTSW	12	81314384	missense	probably damaging	1.00
R7699:Slc8a3	UTSW	12	81314473	missense	probably damaging	1.00
R7759:Slc8a3	UTSW	12	81314551	missense	probably benign
R7960:Slc8a3	UTSW	12	81216732	missense	probably benign	0.00
R7985:Slc8a3	UTSW	12	81314993	missense	probably damaging	1.00
R8059:Slc8a3	UTSW	12	81202258	missense	probably damaging	1.00
R8192:Slc8a3	UTSW	12	81199681	missense	probably damaging	1.00
R8397:Slc8a3	UTSW	12	81199768	missense	probably benign	0.45
R8413:Slc8a3	UTSW	12	81314678	missense	probably damaging	0.97
R8681:Slc8a3	UTSW	12	81315140	missense	probably benign
R9060:Slc8a3	UTSW	12	81214078	missense	probably benign	0.45
R9061:Slc8a3	UTSW	12	81216766	missense	probably damaging	0.99
R9267:Slc8a3	UTSW	12	81314434	missense	possibly damaging	0.77
R9416:Slc8a3	UTSW	12	81315064	missense	probably benign	0.06
R9519:Slc8a3	UTSW	12	81315552	missense	probably benign	0.30
R9531:Slc8a3	UTSW	12	81315223	missense	probably damaging	1.00
X0026:Slc8a3	UTSW	12	81315287	missense	probably benign	0.22
X0028:Slc8a3	UTSW	12	81314943	missense	probably damaging	1.00
Z1177:Slc8a3	UTSW	12	81314700	missense	possibly damaging	0.92
Z1177:Slc8a3	UTSW	12	81315876	missense	probably benign	0.13

Predicted Primers

PCR Primer
(F):5'- GGAAATACCCAGTTCTACTCCTGTCCC -3'
(R):5'- CAGCTCTGCAACCAAACGTCTTG -3'

Sequencing Primer
(F):5'- GTCCCCCACCTTAATTAGCTATC -3'
(R):5'- CAAACGTCTTGGGGACTTAAC -3'

Posted On

2014-04-13