Incidental Mutation 'R1563:Zfhx2'
ID170787
Institutional Source Beutler Lab
Gene Symbol Zfhx2
Ensembl Gene ENSMUSG00000040721
Gene Namezinc finger homeobox 2
Synonymszfh-5
MMRRC Submission 039602-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.414) question?
Stock #R1563 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location55060262-55092324 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 55065088 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 1813 (V1813A)
Ref Sequence ENSEMBL: ENSMUSP00000045156 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036328] [ENSMUST00000183822] [ENSMUST00000185121]
Predicted Effect probably benign
Transcript: ENSMUST00000036328
AA Change: V1813A

PolyPhen 2 Score 0.326 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000045156
Gene: ENSMUSG00000040721
AA Change: V1813A

DomainStartEndE-ValueType
low complexity region 22 42 N/A INTRINSIC
ZnF_C2H2 230 252 1.43e1 SMART
low complexity region 333 345 N/A INTRINSIC
low complexity region 428 439 N/A INTRINSIC
ZnF_C2H2 446 469 8.94e-3 SMART
ZnF_U1 498 532 6.98e-1 SMART
ZnF_C2H2 501 525 3.21e-4 SMART
ZnF_U1 560 594 1.36e0 SMART
ZnF_C2H2 563 587 3.29e-1 SMART
low complexity region 597 623 N/A INTRINSIC
ZnF_C2H2 752 776 6.4e0 SMART
ZnF_C2H2 815 839 2.02e-1 SMART
ZnF_U1 861 895 1.78e1 SMART
ZnF_C2H2 864 888 5.34e-1 SMART
ZnF_C2H2 974 997 1.51e1 SMART
ZnF_C2H2 1003 1026 1.51e0 SMART
low complexity region 1087 1103 N/A INTRINSIC
low complexity region 1106 1126 N/A INTRINSIC
ZnF_U1 1182 1216 3.42e0 SMART
ZnF_C2H2 1185 1209 8.22e-2 SMART
ZnF_U1 1239 1273 3.73e0 SMART
ZnF_C2H2 1242 1266 6.67e-2 SMART
low complexity region 1277 1304 N/A INTRINSIC
low complexity region 1314 1326 N/A INTRINSIC
low complexity region 1332 1346 N/A INTRINSIC
low complexity region 1349 1359 N/A INTRINSIC
low complexity region 1379 1400 N/A INTRINSIC
low complexity region 1457 1465 N/A INTRINSIC
ZnF_C2H2 1474 1497 5.34e0 SMART
low complexity region 1522 1531 N/A INTRINSIC
low complexity region 1542 1554 N/A INTRINSIC
low complexity region 1562 1583 N/A INTRINSIC
HOX 1589 1651 1.97e-16 SMART
low complexity region 1656 1665 N/A INTRINSIC
coiled coil region 1693 1723 N/A INTRINSIC
ZnF_C2H2 1761 1783 2.53e-2 SMART
low complexity region 1837 1847 N/A INTRINSIC
HOX 1851 1913 2.34e-18 SMART
low complexity region 1984 1995 N/A INTRINSIC
low complexity region 2001 2051 N/A INTRINSIC
HOX 2058 2120 1.52e-17 SMART
ZnF_U1 2136 2170 1.09e1 SMART
ZnF_C2H2 2139 2163 5.4e1 SMART
low complexity region 2328 2354 N/A INTRINSIC
low complexity region 2385 2426 N/A INTRINSIC
ZnF_U1 2482 2516 8.31e-1 SMART
ZnF_C2H2 2485 2509 9.46e0 SMART
low complexity region 2523 2538 N/A INTRINSIC
low complexity region 2553 2562 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176665
SMART Domains Protein: ENSMUSP00000134955
Gene: ENSMUSG00000040721

DomainStartEndE-ValueType
ZnF_C2H2 13 37 5.34e-1 SMART
ZnF_C2H2 133 156 1.51e1 SMART
ZnF_C2H2 162 185 1.51e0 SMART
low complexity region 246 262 N/A INTRINSIC
low complexity region 265 285 N/A INTRINSIC
ZnF_C2H2 344 368 8.22e-2 SMART
ZnF_C2H2 401 425 6.67e-2 SMART
low complexity region 436 463 N/A INTRINSIC
low complexity region 473 485 N/A INTRINSIC
low complexity region 491 505 N/A INTRINSIC
low complexity region 508 518 N/A INTRINSIC
low complexity region 538 559 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176872
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183750
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183822
SMART Domains Protein: ENSMUSP00000140371
Gene: ENSMUSG00000045691

DomainStartEndE-ValueType
PDB:2JMU|A 5 64 3e-23 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183993
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185121
Meta Mutation Damage Score 0.0591 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 92.4%
Validation Efficiency 98% (82/84)
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik A G 1: 105,719,534 Y707C probably damaging Het
4930519G04Rik T C 5: 114,863,508 M22T probably benign Het
A930018M24Rik A G 14: 50,897,119 L22P probably damaging Het
Aipl1 A T 11: 72,036,712 M59K probably damaging Het
Atg2b T C 12: 105,623,488 I1835V probably damaging Het
Cacna1i T C 15: 80,321,188 V115A probably damaging Het
Cacna1i A T 15: 80,389,855 probably benign Het
Catsperb T A 12: 101,588,102 M685K probably damaging Het
Cdh10 T A 15: 18,986,767 Y361* probably null Het
Clcn4 C T 7: 7,293,982 C219Y probably damaging Het
Cpeb2 G A 5: 43,285,737 V924M probably damaging Het
Cpxm2 T C 7: 132,143,682 E138G probably benign Het
Dennd1a T C 2: 37,858,429 Y346C probably damaging Het
Dnah8 T A 17: 30,635,664 L100Q probably benign Het
Dnajc6 A C 4: 101,599,137 N76T probably damaging Het
Ehbp1 A G 11: 22,059,231 L954P probably damaging Het
Eral1 A T 11: 78,075,406 D315E probably benign Het
Fam129a A T 1: 151,715,673 Y522F possibly damaging Het
Fbln2 G T 6: 91,263,383 E724* probably null Het
Fyco1 A G 9: 123,827,182 probably benign Het
Fzd3 T A 14: 65,235,724 E198D probably damaging Het
Fzd9 T C 5: 135,250,554 N159S probably damaging Het
Galnt6 T A 15: 100,703,378 Q340L probably benign Het
Gm20939 C T 17: 94,877,094 A390V probably damaging Het
Gm5435 T G 12: 82,495,690 noncoding transcript Het
Gm9949 A C 18: 62,184,018 probably benign Het
Gprc5b G A 7: 118,983,761 T295I probably benign Het
Gria2 G T 3: 80,691,397 Q777K probably damaging Het
Gtf3c3 C T 1: 54,417,778 A488T probably damaging Het
Haao T C 17: 83,834,889 T174A probably benign Het
Hes6 A T 1: 91,413,136 M1K probably null Het
Hook3 G T 8: 26,110,752 Q43K probably benign Het
Klhl35 T C 7: 99,471,695 V390A probably damaging Het
Myh9 G T 15: 77,771,857 T1151K probably damaging Het
Nbn A T 4: 15,981,668 I587F possibly damaging Het
Nek4 A G 14: 30,982,451 D696G probably damaging Het
Nlrp2 T C 7: 5,308,725 D52G probably damaging Het
Oit3 G T 10: 59,428,074 R413S probably damaging Het
Olfr1298 T A 2: 111,645,682 H105L probably damaging Het
Olfr786 A G 10: 129,437,711 M300V probably benign Het
Otof T C 5: 30,371,005 T1870A probably benign Het
Pdgfd T C 9: 6,293,939 probably null Het
Pitrm1 T C 13: 6,563,470 V526A possibly damaging Het
Pknox1 T C 17: 31,595,282 S194P probably damaging Het
Plekhg5 T C 4: 152,096,809 S8P probably benign Het
Ppp1r13b T C 12: 111,840,982 E157G probably damaging Het
Psmd3 C T 11: 98,694,225 R466W probably damaging Het
Ptgfrn A G 3: 101,060,651 F542S possibly damaging Het
Ptgs1 A T 2: 36,245,202 M393L possibly damaging Het
Qpct T A 17: 79,064,063 S87T probably benign Het
Qtrt1 T A 9: 21,419,311 V269D probably benign Het
Rassf9 C G 10: 102,544,960 R68G probably damaging Het
Rif1 A G 2: 52,073,223 E25G probably damaging Het
Rnf213 T C 11: 119,414,526 F528L probably benign Het
Sgip1 T C 4: 102,966,260 S693P probably benign Het
She A G 3: 89,854,614 D460G probably benign Het
Sipa1l1 G T 12: 82,341,161 V54L probably benign Het
Slc8a3 T A 12: 81,205,007 D640V possibly damaging Het
Smurf1 T A 5: 144,882,513 E601D probably damaging Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Synpo2l A G 14: 20,661,278 S425P probably damaging Het
Tbck T C 3: 132,715,693 V187A possibly damaging Het
Tcf23 A T 5: 30,968,831 H18L probably benign Het
Tcp11l2 A G 10: 84,584,944 S16G probably damaging Het
Tekt2 T A 4: 126,323,407 M233L probably benign Het
Tex14 T C 11: 87,536,808 S29P probably damaging Het
Tjp2 T A 19: 24,132,703 N59I probably damaging Het
Tlr5 G A 1: 182,975,010 M626I probably benign Het
Tnn A T 1: 160,125,415 V685D probably damaging Het
Trappc9 G A 15: 73,025,967 R377W probably damaging Het
Trhr G A 15: 44,197,101 V6I probably benign Het
Trim30c C T 7: 104,382,951 R301Q probably benign Het
Usp51 T C X: 153,007,992 I194T probably benign Het
Vmn2r63 A G 7: 42,904,126 S569P probably benign Het
Vps26a T G 10: 62,464,680 I236L probably benign Het
Zc3h7b C T 15: 81,777,088 P376L probably benign Het
Zcchc14 T C 8: 121,603,979 M882V probably benign Het
Zswim2 C T 2: 83,915,282 G604D possibly damaging Het
Zzef1 C T 11: 72,848,733 Q669* probably null Het
Other mutations in Zfhx2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Zfhx2 APN 14 55066565 missense possibly damaging 0.93
IGL00164:Zfhx2 APN 14 55065026 missense possibly damaging 0.73
IGL00235:Zfhx2 APN 14 55063257 missense probably benign 0.11
IGL00925:Zfhx2 APN 14 55073061 missense probably benign 0.06
IGL01025:Zfhx2 APN 14 55064260 missense probably damaging 1.00
IGL01061:Zfhx2 APN 14 55073882 missense possibly damaging 0.96
IGL01486:Zfhx2 APN 14 55067090 missense probably damaging 1.00
IGL01875:Zfhx2 APN 14 55063915 missense unknown
IGL01990:Zfhx2 APN 14 55073590 missense probably damaging 0.99
IGL02097:Zfhx2 APN 14 55062894 missense probably damaging 1.00
IGL02269:Zfhx2 APN 14 55071936 missense probably benign 0.00
IGL02488:Zfhx2 APN 14 55065103 missense possibly damaging 0.72
IGL02624:Zfhx2 APN 14 55066628 missense probably benign 0.06
IGL03087:Zfhx2 APN 14 55072845 missense possibly damaging 0.85
PIT4403001:Zfhx2 UTSW 14 55074980 missense probably benign
R0148:Zfhx2 UTSW 14 55072897 missense possibly damaging 0.86
R0323:Zfhx2 UTSW 14 55065979 missense possibly damaging 0.73
R0328:Zfhx2 UTSW 14 55071988 missense probably benign
R0348:Zfhx2 UTSW 14 55063508 missense probably damaging 0.99
R0442:Zfhx2 UTSW 14 55066900 missense possibly damaging 0.53
R0533:Zfhx2 UTSW 14 55064090 missense probably benign 0.23
R0561:Zfhx2 UTSW 14 55065889 missense probably benign 0.01
R0627:Zfhx2 UTSW 14 55065327 missense probably benign
R0659:Zfhx2 UTSW 14 55073801 missense possibly damaging 0.73
R0675:Zfhx2 UTSW 14 55063163 missense probably damaging 0.99
R1301:Zfhx2 UTSW 14 55063397 missense probably benign 0.32
R1607:Zfhx2 UTSW 14 55062985 missense probably damaging 1.00
R1694:Zfhx2 UTSW 14 55073944 missense possibly damaging 0.91
R1710:Zfhx2 UTSW 14 55065998 missense possibly damaging 0.70
R1773:Zfhx2 UTSW 14 55072891 missense possibly damaging 0.53
R1879:Zfhx2 UTSW 14 55065617 missense probably benign 0.32
R1879:Zfhx2 UTSW 14 55072749 missense possibly damaging 0.96
R1933:Zfhx2 UTSW 14 55075238 start gained probably benign
R1944:Zfhx2 UTSW 14 55074732 missense probably benign 0.18
R2888:Zfhx2 UTSW 14 55064803 missense possibly damaging 0.71
R2889:Zfhx2 UTSW 14 55064803 missense possibly damaging 0.71
R2915:Zfhx2 UTSW 14 55064557 missense probably damaging 0.98
R3971:Zfhx2 UTSW 14 55074475 missense probably benign 0.33
R4082:Zfhx2 UTSW 14 55065205 missense probably benign
R4134:Zfhx2 UTSW 14 55065143 missense possibly damaging 0.93
R4231:Zfhx2 UTSW 14 55073534 missense possibly damaging 0.73
R4675:Zfhx2 UTSW 14 55067221 missense probably benign 0.03
R4764:Zfhx2 UTSW 14 55066915 missense possibly damaging 0.96
R4866:Zfhx2 UTSW 14 55065536 missense possibly damaging 0.73
R4940:Zfhx2 UTSW 14 55066434 missense possibly damaging 0.53
R5125:Zfhx2 UTSW 14 55074775 missense probably benign 0.00
R5178:Zfhx2 UTSW 14 55074775 missense probably benign 0.00
R5554:Zfhx2 UTSW 14 55064317 missense probably damaging 1.00
R5689:Zfhx2 UTSW 14 55073903 missense possibly damaging 0.53
R5768:Zfhx2 UTSW 14 55074365 missense probably benign
R5792:Zfhx2 UTSW 14 55066846 missense possibly damaging 0.72
R5834:Zfhx2 UTSW 14 55073330 nonsense probably null
R5895:Zfhx2 UTSW 14 55065891 missense probably benign
R5999:Zfhx2 UTSW 14 55074005 missense probably benign
R6025:Zfhx2 UTSW 14 55065208 missense probably benign 0.00
R6106:Zfhx2 UTSW 14 55068310 critical splice acceptor site probably null
R6135:Zfhx2 UTSW 14 55074196 missense possibly damaging 0.85
R6186:Zfhx2 UTSW 14 55063160 missense probably damaging 0.99
R6379:Zfhx2 UTSW 14 55074338 missense probably benign
R6725:Zfhx2 UTSW 14 55064082 nonsense probably null
R7089:Zfhx2 UTSW 14 55065772 missense probably benign 0.33
R7383:Zfhx2 UTSW 14 55068253 missense probably benign 0.00
R7470:Zfhx2 UTSW 14 55066750 missense possibly damaging 0.52
R7606:Zfhx2 UTSW 14 55066663 missense probably benign 0.12
R7607:Zfhx2 UTSW 14 55066231 missense possibly damaging 0.86
R7698:Zfhx2 UTSW 14 55062849 missense probably benign 0.00
R7730:Zfhx2 UTSW 14 55066900 missense possibly damaging 0.53
X0065:Zfhx2 UTSW 14 55066960 missense probably benign 0.33
Z1088:Zfhx2 UTSW 14 55074180 missense possibly damaging 0.73
Z1177:Zfhx2 UTSW 14 55065920 missense not run
Z1177:Zfhx2 UTSW 14 55066982 missense not run
Predicted Primers PCR Primer
(F):5'- TCCCACTTCCTCAGAGATACAGTCG -3'
(R):5'- AAGACTTGAGCCAAACGGAGCC -3'

Sequencing Primer
(F):5'- GAGATACAGTCGAGCATCTTCCG -3'
(R):5'- TCTGAAGGGAAGGCACCG -3'
Posted On2014-04-13