Mutagenetix > Incidental Mutation

Incidental Mutation 'R1572:Hectd4'

170832

Institutional Source

Beutler Lab

Gene Symbol

Hectd4

Ensembl Gene

ENSMUSG00000042744

Gene Name

HECT domain E3 ubiquitin protein ligase 4

Synonyms

Gm15800

MMRRC Submission

039611-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.923) question?

Stock #

R1572 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

121220219-121368577 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 121301878 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 1147 (D1147G)

Ref Sequence

ENSEMBL: ENSMUSP00000048345 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000042614] [ENSMUST00000100769]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000042614
AA Change: D1147G

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000048345
Gene: ENSMUSG00000042744
AA Change: D1147G

Domain	Start	End	E-Value	Type
low complexity region	224	234	N/A	INTRINSIC
low complexity region	266	282	N/A	INTRINSIC
low complexity region	553	564	N/A	INTRINSIC
low complexity region	725	735	N/A	INTRINSIC
low complexity region	1252	1265	N/A	INTRINSIC
coiled coil region	1372	1398	N/A	INTRINSIC
low complexity region	1551	1562	N/A	INTRINSIC
low complexity region	1725	1741	N/A	INTRINSIC
low complexity region	1892	1904	N/A	INTRINSIC
low complexity region	2656	2666	N/A	INTRINSIC
low complexity region	2857	2872	N/A	INTRINSIC
low complexity region	2901	2917	N/A	INTRINSIC
low complexity region	2921	2933	N/A	INTRINSIC
low complexity region	3232	3246	N/A	INTRINSIC
low complexity region	3275	3335	N/A	INTRINSIC
low complexity region	3441	3448	N/A	INTRINSIC
low complexity region	3473	3506	N/A	INTRINSIC
low complexity region	3512	3533	N/A	INTRINSIC
low complexity region	3540	3554	N/A	INTRINSIC
low complexity region	3794	3822	N/A	INTRINSIC
HECTc	4048	4412	4.78e-11	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000100769

SMART Domains

Protein: ENSMUSP00000098332
Gene: ENSMUSG00000042744

Domain	Start	End	E-Value	Type
coiled coil region	35	61	N/A	INTRINSIC
low complexity region	214	225	N/A	INTRINSIC
low complexity region	388	404	N/A	INTRINSIC
low complexity region	555	567	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000128514

Predicted Effect

probably benign
Transcript: ENSMUST00000148368

Predicted Effect

unknown
Transcript: ENSMUST00000201669
AA Change: D507G

Meta Mutation Damage Score

0.1391

Coding Region Coverage

1x: 98.7%
3x: 97.5%
10x: 92.9%
20x: 80.7%

Validation Efficiency

97% (130/134)

Allele List at MGI

Other mutations in this stock

Total: 112 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310030G06Rik	G	A	9: 50,740,673	T85M	probably damaging	Het
5430419D17Rik	T	A	7: 131,244,831	Y777*	probably null	Het
Actn1	A	G	12: 80,172,957		probably benign	Het
Afap1l1	A	T	18: 61,737,499	S603T	probably damaging	Het
Ahcy	T	C	2: 155,068,931	Y39C	probably benign	Het
Ankmy2	T	C	12: 36,186,942		probably null	Het
Anxa13	A	T	15: 58,348,807		noncoding transcript	Het
Aoc1	T	C	6: 48,905,786	S221P	possibly damaging	Het
Arhgef10	C	A	8: 14,991,211	A770D	possibly damaging	Het
Arhgef19	A	G	4: 141,254,754	D707G	probably benign	Het
Arhgef3	G	A	14: 27,401,735	R444H	probably damaging	Het
Asphd1	T	C	7: 126,949,099	I11V	probably benign	Het
Atp2b1	A	G	10: 98,994,675	M333V	probably benign	Het
BC051665	T	C	13: 60,785,027	Y40C	probably damaging	Het
Ccdc87	T	A	19: 4,840,313	S278T	probably benign	Het
Chaf1b	G	A	16: 93,901,230	G463D	possibly damaging	Het
Chrna4	T	C	2: 181,029,307	T219A	possibly damaging	Het
Clcnkb	T	G	4: 141,407,095	T584P	possibly damaging	Het
Clptm1l	T	C	13: 73,607,747	S161P	probably benign	Het
Cmya5	T	C	13: 93,094,269	E1437G	possibly damaging	Het
Col13a1	A	T	10: 61,866,426		probably null	Het
Col3a1	T	C	1: 45,345,968	S82P	possibly damaging	Het
Cpeb3	A	T	19: 37,139,082	M383K	probably benign	Het
Cr2	T	A	1: 195,163,314	H111L	probably damaging	Het
Cttnbp2	T	C	6: 18,375,975	S1522G	possibly damaging	Het
Cul3	T	C	1: 80,282,789	D281G	possibly damaging	Het
Cyp2c70	T	G	19: 40,183,982	K72T	probably benign	Het
Cyp39a1	A	T	17: 43,680,129	I110F	probably damaging	Het
Cyp46a1	T	A	12: 108,351,939	M203K	probably null	Het
Cyp8b1	A	T	9: 121,914,958	V436D	possibly damaging	Het
Ddx17	T	C	15: 79,538,565	D324G	probably damaging	Het
Dopey2	A	G	16: 93,770,153	N1274S	probably damaging	Het
Dscaml1	G	A	9: 45,721,333	V1166I	probably benign	Het
Dsp	T	C	13: 38,195,738	V1554A	probably damaging	Het
Dusp27	C	T	1: 166,099,455	V863M	possibly damaging	Het
Efr3a	T	A	15: 65,854,792		probably null	Het
Egfem1	A	T	3: 29,648,271	N223I	probably benign	Het
Egr2	T	C	10: 67,539,975	S147P	probably damaging	Het
Elmo3	A	G	8: 105,308,301	T408A	probably benign	Het
Flnb	A	G	14: 7,883,908	D378G	probably damaging	Het
Foxj2	T	A	6: 122,833,261	M193K	probably benign	Het
Gm6327	A	G	16: 12,760,156		noncoding transcript	Het
Gm7694	T	C	1: 170,302,766	H21R	probably benign	Het
Gpr107	A	G	2: 31,167,025	D43G	probably damaging	Het
Grid2	T	A	6: 64,429,694	Y679*	probably null	Het
Grin2c	G	A	11: 115,256,074	P432S	possibly damaging	Het
H2-M10.1	A	G	17: 36,325,733	F60L	possibly damaging	Het
Idua	G	T	5: 108,680,589	A223S	probably benign	Het
Ifi206	T	C	1: 173,486,853	Q7R	probably benign	Het
Itgad	T	A	7: 128,203,234	V986E	probably damaging	Het
Itsn2	G	A	12: 4,650,044	R670H	probably benign	Het
Kdm4a	T	C	4: 118,138,949	E961G	possibly damaging	Het
Klra5	T	A	6: 129,906,622	I91L	probably damaging	Het
Kntc1	A	G	5: 123,772,113	T525A	probably damaging	Het
Lct	A	G	1: 128,294,195	F1536L	probably benign	Het
Lmod1	T	A	1: 135,363,933	D175E	probably benign	Het
Lonrf1	A	C	8: 36,233,972	D361E	probably benign	Het
Lrrc19	T	C	4: 94,638,429	Y297C	probably damaging	Het
Mast4	T	C	13: 102,736,923	E1787G	possibly damaging	Het
Mpp2	G	A	11: 102,060,548	A452V	probably benign	Het
Msh2	T	C	17: 87,718,652	V686A	possibly damaging	Het
Mthfd1	C	T	12: 76,270,419	Q15*	probably null	Het
Mtnr1b	A	T	9: 15,863,142	I207N	probably damaging	Het
Nid2	A	G	14: 19,805,412	T1207A	probably benign	Het
Nin	A	T	12: 70,038,750	V1569D	probably damaging	Het
Nov	T	A	15: 54,749,252	M219K	possibly damaging	Het
Nrcam	T	A	12: 44,537,364		probably benign	Het
Nsd1	T	A	13: 55,246,969	H897Q	probably damaging	Het
Olfr102	A	T	17: 37,313,480	N301K	probably benign	Het
Olfr1364	T	A	13: 21,574,310	I49F	possibly damaging	Het
Olfr77	G	T	9: 19,920,912	K234N	probably benign	Het
Olfr979	A	G	9: 40,001,194	F11S	probably benign	Het
Paip1	T	C	13: 119,451,784		probably benign	Het
Pcnx3	G	A	19: 5,685,347	R484*	probably null	Het
Pdxk	A	G	10: 78,447,980	Y127H	probably damaging	Het
Phf20	T	A	2: 156,287,834	V442E	probably benign	Het
Phlpp1	G	A	1: 106,392,789	D1505N	probably damaging	Het
Pkhd1	T	C	1: 20,347,440	T2496A	probably benign	Het
Pkhd1l1	A	G	15: 44,543,473	T2369A	probably benign	Het
Plod2	T	A	9: 92,603,067		probably benign	Het
Pnpla7	T	A	2: 25,015,251	M617K	possibly damaging	Het
Ppp1r16a	C	T	15: 76,693,669	Q328*	probably null	Het
Prkch	T	A	12: 73,649,357		probably null	Het
Prr12	G	A	7: 45,028,800	H1974Y	unknown	Het
Prr16	A	G	18: 51,302,970	I174V	probably benign	Het
Prss45	A	T	9: 110,838,429	T39S	probably benign	Het
Pum1	T	A	4: 130,718,204	D161E	probably damaging	Het
Rad51ap2	A	G	12: 11,457,112	D345G	probably damaging	Het
Ralgapb	A	G	2: 158,446,199		probably benign	Het
Rasgrp3	A	G	17: 75,500,734	H262R	possibly damaging	Het
Rnf213	T	A	11: 119,436,611	I1809N	probably damaging	Het
Ryr1	A	G	7: 29,062,191	L3177P	probably damaging	Het
Scyl2	C	A	10: 89,650,956	R230L	probably damaging	Het
Sfxn2	T	C	19: 46,582,476		probably benign	Het
Slc18b1	T	C	10: 23,798,741		probably benign	Het
Spata31d1d	T	C	13: 59,728,191	H510R	probably benign	Het
Stab1	A	T	14: 31,150,823	N1109K	probably damaging	Het
Sult3a2	A	G	10: 33,781,977	S47P	probably damaging	Het
Tenm3	T	C	8: 48,228,993	N2518S	possibly damaging	Het
Tex21	G	T	12: 76,206,891	P416Q	probably benign	Het
Tex38	T	C	4: 115,780,306	N100S	probably benign	Het
Thsd4	A	C	9: 60,394,553		probably benign	Het
Ticrr	T	C	7: 79,681,824	V723A	probably damaging	Het
Tmprss15	A	G	16: 79,090,829	V30A	probably benign	Het
Uba3	A	G	6: 97,185,337		probably benign	Het
Ubr1	T	C	2: 120,935,319		probably benign	Het
Uchl4	A	T	9: 64,235,731	I165L	probably benign	Het
Vmn2r112	A	T	17: 22,603,144	T268S	possibly damaging	Het
Wfdc3	T	C	2: 164,744,194		probably benign	Het
Zfp282	T	A	6: 47,892,867	L282Q	probably damaging	Het
Zfp422	A	T	6: 116,626,784	C85S	probably damaging	Het
Zfp790	A	T	7: 29,828,139	Q83L	probably benign	Het

Other mutations in Hectd4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00156:Hectd4	APN	5	121363870	missense	possibly damaging	0.51
IGL00976:Hectd4	APN	5	121349106	missense	probably benign	0.18
IGL01085:Hectd4	APN	5	121331701	missense	probably damaging	1.00
IGL01112:Hectd4	APN	5	121306950	missense	probably benign	0.01
IGL01402:Hectd4	APN	5	121339417	splice site	probably benign
IGL01474:Hectd4	APN	5	121336649	missense	possibly damaging	0.53
IGL01503:Hectd4	APN	5	121318651	missense	probably benign	0.28
IGL01548:Hectd4	APN	5	121364660	missense	possibly damaging	0.71
IGL01656:Hectd4	APN	5	121322700	missense	probably damaging	0.99
IGL01756:Hectd4	APN	5	121344824	missense	probably benign	0.28
IGL01819:Hectd4	APN	5	121328418	missense	possibly damaging	0.85
IGL02080:Hectd4	APN	5	121366606	utr 3 prime	probably benign
IGL02488:Hectd4	APN	5	121292087	missense	probably benign	0.33
IGL02490:Hectd4	APN	5	121318613	missense	possibly damaging	0.82
IGL02558:Hectd4	APN	5	121344785	missense	probably benign	0.28
IGL02626:Hectd4	APN	5	121353881	missense	possibly damaging	0.86
IGL02649:Hectd4	APN	5	121349402	missense	possibly damaging	0.73
IGL02736:Hectd4	APN	5	121342719	missense	possibly damaging	0.73
IGL02861:Hectd4	APN	5	121307004	missense	possibly damaging	0.81
IGL02880:Hectd4	APN	5	121365053	missense	possibly damaging	0.93
IGL02889:Hectd4	APN	5	121365053	missense	possibly damaging	0.93
IGL02953:Hectd4	APN	5	121365053	missense	possibly damaging	0.93
IGL02969:Hectd4	APN	5	121365053	missense	possibly damaging	0.93
IGL03031:Hectd4	APN	5	121348794	missense	possibly damaging	0.96
IGL03066:Hectd4	APN	5	121365053	missense	possibly damaging	0.93
IGL03160:Hectd4	APN	5	121259879	missense	probably benign
IGL03181:Hectd4	APN	5	121353958	missense	possibly damaging	0.91
IGL03265:Hectd4	APN	5	121259939	splice site	probably benign
IGL03375:Hectd4	APN	5	121328382	missense	possibly damaging	0.72
Achilles	UTSW	5	121307381	nonsense	probably null
agamemnon	UTSW	5	121253858	splice site	probably benign
clymnestra	UTSW	5	121334375	missense	possibly damaging	0.86
hector	UTSW	5	121315437	missense	probably damaging	1.00
helen	UTSW	5	121310663	missense	probably damaging	0.97
Merriwether	UTSW	5	121353551	missense	possibly damaging	0.53
PIT4466001:Hectd4	UTSW	5	121333060	critical splice donor site	probably null
R0018:Hectd4	UTSW	5	121254179	missense	possibly damaging	0.53
R0024:Hectd4	UTSW	5	121308576	missense	possibly damaging	0.92
R0030:Hectd4	UTSW	5	121262588	nonsense	probably null
R0080:Hectd4	UTSW	5	121349372	missense	probably benign	0.18
R0110:Hectd4	UTSW	5	121281896	missense	possibly damaging	0.90
R0110:Hectd4	UTSW	5	121305673	missense	possibly damaging	0.53
R0115:Hectd4	UTSW	5	121295506	splice site	probably benign
R0128:Hectd4	UTSW	5	121349243	missense	possibly damaging	0.86
R0131:Hectd4	UTSW	5	121333024	missense	probably benign	0.44
R0131:Hectd4	UTSW	5	121333024	missense	probably benign	0.44
R0132:Hectd4	UTSW	5	121333024	missense	probably benign	0.44
R0244:Hectd4	UTSW	5	121329605	missense	probably benign	0.33
R0281:Hectd4	UTSW	5	121254251	missense	possibly damaging	0.85
R0329:Hectd4	UTSW	5	121259864	missense	probably benign
R0410:Hectd4	UTSW	5	121286266	missense	possibly damaging	0.86
R0422:Hectd4	UTSW	5	121343082	splice site	probably null
R0442:Hectd4	UTSW	5	121323982	missense	possibly damaging	0.66
R0449:Hectd4	UTSW	5	121364590	splice site	probably null
R0469:Hectd4	UTSW	5	121281896	missense	possibly damaging	0.90
R0469:Hectd4	UTSW	5	121305673	missense	possibly damaging	0.53
R0481:Hectd4	UTSW	5	121295506	splice site	probably benign
R0510:Hectd4	UTSW	5	121281896	missense	possibly damaging	0.90
R0510:Hectd4	UTSW	5	121305673	missense	possibly damaging	0.53
R0520:Hectd4	UTSW	5	121331707	missense	possibly damaging	0.53
R0534:Hectd4	UTSW	5	121348476	missense	possibly damaging	0.96
R0603:Hectd4	UTSW	5	121304337	missense	possibly damaging	0.46
R0617:Hectd4	UTSW	5	121343232	splice site	probably benign
R0622:Hectd4	UTSW	5	121348625	missense	possibly damaging	0.53
R0626:Hectd4	UTSW	5	121277824	missense	probably benign	0.18
R0708:Hectd4	UTSW	5	121286463	critical splice donor site	probably null
R0710:Hectd4	UTSW	5	121336628	missense	probably benign	0.08
R0763:Hectd4	UTSW	5	121307033	unclassified	probably benign
R0764:Hectd4	UTSW	5	121286769	missense	possibly damaging	0.46
R1123:Hectd4	UTSW	5	121286736	missense	probably damaging	0.96
R1129:Hectd4	UTSW	5	121310599	missense	possibly damaging	0.66
R1204:Hectd4	UTSW	5	121350485	missense	possibly damaging	0.85
R1237:Hectd4	UTSW	5	121321507	missense	possibly damaging	0.90
R1257:Hectd4	UTSW	5	121318624	nonsense	probably null
R1391:Hectd4	UTSW	5	121353695	missense	possibly damaging	0.96
R1395:Hectd4	UTSW	5	121328513	critical splice donor site	probably null
R1468:Hectd4	UTSW	5	121349172	missense	possibly damaging	0.65
R1468:Hectd4	UTSW	5	121349172	missense	possibly damaging	0.65
R1545:Hectd4	UTSW	5	121323956	missense	possibly damaging	0.87
R1553:Hectd4	UTSW	5	121349259	missense	probably benign	0.00
R1662:Hectd4	UTSW	5	121317245	missense	probably benign	0.01
R1705:Hectd4	UTSW	5	121298104	missense	probably benign
R1715:Hectd4	UTSW	5	121344818	missense	possibly damaging	0.85
R1728:Hectd4	UTSW	5	121301839	missense	possibly damaging	0.51
R1736:Hectd4	UTSW	5	121349530	missense	possibly damaging	0.53
R1768:Hectd4	UTSW	5	121358303	missense	possibly damaging	0.70
R1775:Hectd4	UTSW	5	121291191	splice site	probably benign
R1784:Hectd4	UTSW	5	121301839	missense	possibly damaging	0.51
R1843:Hectd4	UTSW	5	121297180	missense	possibly damaging	0.53
R1914:Hectd4	UTSW	5	121322294	missense	probably benign	0.08
R1915:Hectd4	UTSW	5	121322294	missense	probably benign	0.08
R2024:Hectd4	UTSW	5	121281918	missense	possibly damaging	0.86
R2103:Hectd4	UTSW	5	121355629	missense	probably benign	0.04
R2108:Hectd4	UTSW	5	121333424	missense	possibly damaging	0.72
R2124:Hectd4	UTSW	5	121318639	missense	probably damaging	0.97
R2150:Hectd4	UTSW	5	121253858	splice site	probably benign
R2192:Hectd4	UTSW	5	121315143	missense	possibly damaging	0.46
R2301:Hectd4	UTSW	5	121353537	missense	probably benign	0.18
R2324:Hectd4	UTSW	5	121315437	missense	probably damaging	1.00
R2331:Hectd4	UTSW	5	121320026	missense	probably benign	0.05
R2504:Hectd4	UTSW	5	121220620	missense	unknown
R2504:Hectd4	UTSW	5	121263967	missense	possibly damaging	0.73
R2904:Hectd4	UTSW	5	121292724	splice site	probably benign
R3843:Hectd4	UTSW	5	121259873	missense	possibly damaging	0.72
R3934:Hectd4	UTSW	5	121320101	critical splice donor site	probably null
R3944:Hectd4	UTSW	5	121303525	splice site	probably benign
R4133:Hectd4	UTSW	5	121277834	critical splice donor site	probably null
R4271:Hectd4	UTSW	5	121220504	small deletion	probably benign
R4413:Hectd4	UTSW	5	121350481	missense	possibly damaging	0.53
R4456:Hectd4	UTSW	5	121308271	missense	possibly damaging	0.65
R4489:Hectd4	UTSW	5	121286257	missense	possibly damaging	0.73
R4539:Hectd4	UTSW	5	121314907	nonsense	probably null
R4564:Hectd4	UTSW	5	121350431	missense	probably benign	0.33
R4582:Hectd4	UTSW	5	121286419	missense	possibly damaging	0.53
R4629:Hectd4	UTSW	5	121297203	missense	probably benign	0.01
R4633:Hectd4	UTSW	5	121349216	missense	probably benign	0.33
R4643:Hectd4	UTSW	5	121349055	missense	possibly damaging	0.53
R4679:Hectd4	UTSW	5	121325251	missense	possibly damaging	0.72
R4681:Hectd4	UTSW	5	121303615	missense	possibly damaging	0.86
R4734:Hectd4	UTSW	5	121341977	missense	possibly damaging	0.53
R4739:Hectd4	UTSW	5	121348442	missense	probably benign
R4781:Hectd4	UTSW	5	121306107	critical splice donor site	probably null
R4860:Hectd4	UTSW	5	121305818	missense	probably benign	0.04
R4860:Hectd4	UTSW	5	121305818	missense	probably benign	0.04
R4869:Hectd4	UTSW	5	121322672	missense	possibly damaging	0.46
R4909:Hectd4	UTSW	5	121263891	missense	probably benign	0.18
R4922:Hectd4	UTSW	5	121359315	missense	possibly damaging	0.86
R4925:Hectd4	UTSW	5	121322690	missense	possibly damaging	0.83
R5004:Hectd4	UTSW	5	121328199	splice site	probably null
R5004:Hectd4	UTSW	5	121329565	missense	possibly damaging	0.93
R5129:Hectd4	UTSW	5	121343510	missense	possibly damaging	0.87
R5217:Hectd4	UTSW	5	121353551	missense	possibly damaging	0.53
R5267:Hectd4	UTSW	5	121344824	missense	probably benign	0.28
R5344:Hectd4	UTSW	5	121343676	missense	probably benign	0.28
R5345:Hectd4	UTSW	5	121263974	missense	possibly damaging	0.85
R5347:Hectd4	UTSW	5	121304448	missense	probably benign	0.33
R5360:Hectd4	UTSW	5	121315401	missense	possibly damaging	0.90
R5363:Hectd4	UTSW	5	121310603	missense	probably benign	0.04
R5445:Hectd4	UTSW	5	121266274	missense	probably benign	0.00
R5479:Hectd4	UTSW	5	121306948	missense	probably benign
R5507:Hectd4	UTSW	5	121281101	missense	unknown
R5552:Hectd4	UTSW	5	121342851	missense	possibly damaging	0.96
R5691:Hectd4	UTSW	5	121348815	missense	possibly damaging	0.85
R5745:Hectd4	UTSW	5	121353502	missense	possibly damaging	0.96
R5757:Hectd4	UTSW	5	121348619	missense	possibly damaging	0.72
R5845:Hectd4	UTSW	5	121307524	critical splice donor site	probably null
R5869:Hectd4	UTSW	5	121343225	critical splice donor site	probably null
R5913:Hectd4	UTSW	5	121323974	missense	possibly damaging	0.83
R5920:Hectd4	UTSW	5	121308271	missense	possibly damaging	0.65
R5943:Hectd4	UTSW	5	121322294	missense	probably benign	0.01
R6219:Hectd4	UTSW	5	121308878	missense	possibly damaging	0.92
R6250:Hectd4	UTSW	5	121339498	missense	possibly damaging	0.85
R6301:Hectd4	UTSW	5	121254220	missense	possibly damaging	0.91
R6428:Hectd4	UTSW	5	121350445	missense	possibly damaging	0.53
R6446:Hectd4	UTSW	5	121334375	missense	possibly damaging	0.86
R6453:Hectd4	UTSW	5	121350592	missense	probably damaging	1.00
R6513:Hectd4	UTSW	5	121356196	splice site	probably null
R6540:Hectd4	UTSW	5	121303571	missense	probably benign	0.33
R6706:Hectd4	UTSW	5	121320084	missense	possibly damaging	0.92
R6720:Hectd4	UTSW	5	121307381	nonsense	probably null
R6736:Hectd4	UTSW	5	121277725	missense	possibly damaging	0.86
R6776:Hectd4	UTSW	5	121353511	missense	possibly damaging	0.85
R7033:Hectd4	UTSW	5	121364568	missense	possibly damaging	0.86
R7038:Hectd4	UTSW	5	121299597	missense	possibly damaging	0.90
R7175:Hectd4	UTSW	5	121273629	missense	possibly damaging	0.85
R7180:Hectd4	UTSW	5	121308342	missense	probably benign	0.01
R7234:Hectd4	UTSW	5	121329073	missense	possibly damaging	0.53
R7253:Hectd4	UTSW	5	121314881	missense	possibly damaging	0.66
R7349:Hectd4	UTSW	5	121310663	missense	probably damaging	0.97
R7450:Hectd4	UTSW	5	121281932	missense	probably benign	0.00
R7467:Hectd4	UTSW	5	121323961	missense	possibly damaging	0.66
R7475:Hectd4	UTSW	5	121358133	splice site	probably null
R7482:Hectd4	UTSW	5	121363878	missense	possibly damaging	0.71
R7512:Hectd4	UTSW	5	121297109	missense	possibly damaging	0.72
R7525:Hectd4	UTSW	5	121343665	missense	possibly damaging	0.70
R7559:Hectd4	UTSW	5	121315510	splice site	probably null
R7560:Hectd4	UTSW	5	121254342	missense	possibly damaging	0.53
R7561:Hectd4	UTSW	5	121291225	missense	possibly damaging	0.91
R7576:Hectd4	UTSW	5	121349459	missense	possibly damaging	0.91
R7584:Hectd4	UTSW	5	121318735	missense	possibly damaging	0.83
R7648:Hectd4	UTSW	5	121254371	missense	possibly damaging	0.73
R7663:Hectd4	UTSW	5	121324031	missense	probably benign	0.06
R7692:Hectd4	UTSW	5	121321564	missense	possibly damaging	0.46
R7725:Hectd4	UTSW	5	121220617	missense	unknown
R7731:Hectd4	UTSW	5	121307014	missense	probably benign	0.00
R7732:Hectd4	UTSW	5	121336629	missense	probably benign	0.14
R7782:Hectd4	UTSW	5	121305721	missense	possibly damaging	0.53
R7854:Hectd4	UTSW	5	121329568	missense	probably benign	0.27
R7898:Hectd4	UTSW	5	121331817	missense	probably benign	0.18
R7910:Hectd4	UTSW	5	121254228	missense	possibly damaging	0.86
R7962:Hectd4	UTSW	5	121310629	missense	probably damaging	0.98
R8003:Hectd4	UTSW	5	121339518	missense	possibly damaging	0.85
R8098:Hectd4	UTSW	5	121321398	missense	possibly damaging	0.46
R8110:Hectd4	UTSW	5	121332949	missense	possibly damaging	0.96
R8118:Hectd4	UTSW	5	121286376	missense	probably benign	0.33
R8171:Hectd4	UTSW	5	121318756	missense	possibly damaging	0.82
R8234:Hectd4	UTSW	5	121339544	missense	possibly damaging	0.72
R8289:Hectd4	UTSW	5	121266361	missense	possibly damaging	0.53
R8292:Hectd4	UTSW	5	121317225	missense	possibly damaging	0.66
R8348:Hectd4	UTSW	5	121220256	start gained	probably benign
R8397:Hectd4	UTSW	5	121259894	missense	probably damaging	0.98
R8436:Hectd4	UTSW	5	121308358	missense	possibly damaging	0.90
R8436:Hectd4	UTSW	5	121343147	missense	probably benign	0.00
R8443:Hectd4	UTSW	5	121329109	missense	possibly damaging	0.72
R8448:Hectd4	UTSW	5	121220256	start gained	probably benign
R8516:Hectd4	UTSW	5	121349010	missense	possibly damaging	0.53
R8519:Hectd4	UTSW	5	121304426	nonsense	probably null
R8553:Hectd4	UTSW	5	121353598	missense	possibly damaging	0.73
R8557:Hectd4	UTSW	5	121310651	missense	possibly damaging	0.66
R8725:Hectd4	UTSW	5	121350494	missense	probably damaging	1.00
R8751:Hectd4	UTSW	5	121363775	nonsense	probably null
R8769:Hectd4	UTSW	5	121281873	missense	possibly damaging	0.53
R8803:Hectd4	UTSW	5	121323931	missense	probably benign	0.01
R8887:Hectd4	UTSW	5	121295478	missense	probably benign	0.44
R8982:Hectd4	UTSW	5	121328242	missense	probably benign	0.02
R8988:Hectd4	UTSW	5	121277756	missense	possibly damaging	0.86
R8991:Hectd4	UTSW	5	121358284	missense	probably benign	0.33
R8994:Hectd4	UTSW	5	121303566	missense	probably benign	0.33
R8995:Hectd4	UTSW	5	121254359	missense	possibly damaging	0.96
R9049:Hectd4	UTSW	5	121313892	missense	possibly damaging	0.92
R9093:Hectd4	UTSW	5	121273614	missense	probably benign	0.14
R9106:Hectd4	UTSW	5	121329556	missense	possibly damaging	0.53
R9137:Hectd4	UTSW	5	121358175	missense	possibly damaging	0.53
R9146:Hectd4	UTSW	5	121349034	missense	probably benign	0.33
R9154:Hectd4	UTSW	5	121253904	missense
R9162:Hectd4	UTSW	5	121306979	missense	possibly damaging	0.66
R9166:Hectd4	UTSW	5	121308627	missense	probably damaging	0.96
R9183:Hectd4	UTSW	5	121299488	missense	possibly damaging	0.51
R9207:Hectd4	UTSW	5	121295433	missense	possibly damaging	0.86
R9291:Hectd4	UTSW	5	121348965	missense	probably benign	0.14
R9300:Hectd4	UTSW	5	121348889	missense	probably benign	0.33
R9314:Hectd4	UTSW	5	121299645	critical splice donor site	probably null
R9381:Hectd4	UTSW	5	121334429	missense	possibly damaging	0.53
R9432:Hectd4	UTSW	5	121322801	missense	probably benign	0.01
R9491:Hectd4	UTSW	5	121314918	missense	probably damaging	0.97
R9532:Hectd4	UTSW	5	121364553	missense	probably benign	0.00
R9557:Hectd4	UTSW	5	121321554	missense	possibly damaging	0.66
R9561:Hectd4	UTSW	5	121334469	missense	possibly damaging	0.53
R9593:Hectd4	UTSW	5	121286781	nonsense	probably null
R9704:Hectd4	UTSW	5	121310681	missense	probably benign	0.00
R9705:Hectd4	UTSW	5	121310681	missense	probably benign	0.00
R9712:Hectd4	UTSW	5	121310681	missense	probably benign	0.00
R9713:Hectd4	UTSW	5	121310681	missense	probably benign	0.00
R9726:Hectd4	UTSW	5	121310681	missense	probably benign	0.00
R9732:Hectd4	UTSW	5	121254191	nonsense	probably null
R9750:Hectd4	UTSW	5	121310681	missense	probably benign	0.00
R9752:Hectd4	UTSW	5	121310681	missense	probably benign	0.00
R9752:Hectd4	UTSW	5	121334352	missense	possibly damaging	0.85
R9772:Hectd4	UTSW	5	121310681	missense	probably benign	0.00
X0026:Hectd4	UTSW	5	121349637	missense	probably benign	0.04
X0027:Hectd4	UTSW	5	121321404	missense	probably benign	0.27
Z1088:Hectd4	UTSW	5	121295503	splice site	probably null
Z1177:Hectd4	UTSW	5	121358320	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- GATCTTAGTGTCCCTGTGCCAACC -3'
(R):5'- CCATACCAATGTGGCCCTAACTAGC -3'

Sequencing Primer
(F):5'- TACCAGGGTCTGGCTATAAATG -3'
(R):5'- GTGGCCCTAACTAGCTAACTATGTG -3'

Posted On

2014-04-13