Incidental Mutation 'R1572:Ryr1'
ID170843
Institutional Source Beutler Lab
Gene Symbol Ryr1
Ensembl Gene ENSMUSG00000030592
Gene Nameryanodine receptor 1, skeletal muscle
Synonymsskrr, calcium release channel isoform 1, Ryr
MMRRC Submission 039611-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1572 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location29003344-29125179 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 29062191 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 3177 (L3177P)
Ref Sequence ENSEMBL: ENSMUSP00000149042 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032813] [ENSMUST00000179893] [ENSMUST00000214374]
Predicted Effect probably damaging
Transcript: ENSMUST00000032813
AA Change: L3170P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000032813
Gene: ENSMUSG00000030592
AA Change: L3170P

DomainStartEndE-ValueType
low complexity region 2 11 N/A INTRINSIC
MIR 99 154 7.52e-4 SMART
MIR 161 206 1.11e-6 SMART
MIR 212 266 1.23e-8 SMART
MIR 272 362 1.05e-25 SMART
Pfam:RYDR_ITPR 441 645 1.2e-73 PFAM
SPRY 660 798 2.79e-27 SMART
Pfam:RyR 851 945 6.5e-33 PFAM
Pfam:RyR 965 1059 1.5e-30 PFAM
SPRY 1086 1209 8.62e-42 SMART
low complexity region 1318 1332 N/A INTRINSIC
low complexity region 1340 1349 N/A INTRINSIC
SPRY 1431 1571 3.05e-33 SMART
low complexity region 1787 1798 N/A INTRINSIC
coiled coil region 1871 1932 N/A INTRINSIC
low complexity region 1989 1998 N/A INTRINSIC
low complexity region 2048 2057 N/A INTRINSIC
low complexity region 2069 2092 N/A INTRINSIC
Pfam:RYDR_ITPR 2158 2366 7e-66 PFAM
low complexity region 2390 2404 N/A INTRINSIC
Pfam:RyR 2735 2829 9.7e-34 PFAM
Pfam:RyR 2855 2943 5.7e-32 PFAM
low complexity region 3130 3144 N/A INTRINSIC
low complexity region 3290 3304 N/A INTRINSIC
low complexity region 3375 3394 N/A INTRINSIC
PDB:2BCX|B 3613 3642 2e-13 PDB
low complexity region 3681 3691 N/A INTRINSIC
low complexity region 3735 3760 N/A INTRINSIC
Pfam:RIH_assoc 3872 4004 1.9e-41 PFAM
low complexity region 4010 4023 N/A INTRINSIC
Pfam:EF-hand_8 4085 4136 9.8e-8 PFAM
transmembrane domain 4283 4305 N/A INTRINSIC
transmembrane domain 4318 4336 N/A INTRINSIC
transmembrane domain 4341 4363 N/A INTRINSIC
Pfam:RR_TM4-6 4377 4666 2e-86 PFAM
Pfam:Ion_trans 4761 4932 3.4e-10 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000179893
AA Change: L3170P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000137123
Gene: ENSMUSG00000030592
AA Change: L3170P

DomainStartEndE-ValueType
low complexity region 2 11 N/A INTRINSIC
MIR 99 154 7.52e-4 SMART
MIR 161 206 1.11e-6 SMART
MIR 212 266 1.23e-8 SMART
MIR 272 362 1.05e-25 SMART
Pfam:RYDR_ITPR 443 638 4.5e-63 PFAM
SPRY 660 798 2.79e-27 SMART
Pfam:RyR 852 942 1.3e-37 PFAM
Pfam:RyR 966 1056 1.6e-28 PFAM
SPRY 1086 1209 8.62e-42 SMART
low complexity region 1318 1332 N/A INTRINSIC
low complexity region 1340 1349 N/A INTRINSIC
SPRY 1431 1571 3.05e-33 SMART
low complexity region 1787 1798 N/A INTRINSIC
coiled coil region 1871 1932 N/A INTRINSIC
low complexity region 1989 1998 N/A INTRINSIC
low complexity region 2048 2057 N/A INTRINSIC
low complexity region 2069 2092 N/A INTRINSIC
Pfam:RYDR_ITPR 2160 2366 2.2e-68 PFAM
low complexity region 2390 2404 N/A INTRINSIC
Pfam:RyR 2736 2826 7.2e-31 PFAM
Pfam:RyR 2856 2940 5.6e-27 PFAM
low complexity region 3130 3144 N/A INTRINSIC
low complexity region 3290 3304 N/A INTRINSIC
low complexity region 3375 3394 N/A INTRINSIC
PDB:2BCX|B 3615 3644 2e-13 PDB
low complexity region 3683 3693 N/A INTRINSIC
low complexity region 3737 3762 N/A INTRINSIC
Pfam:RIH_assoc 3878 3996 6.2e-35 PFAM
low complexity region 4012 4025 N/A INTRINSIC
Pfam:EF-hand_8 4087 4137 1.8e-8 PFAM
transmembrane domain 4285 4307 N/A INTRINSIC
transmembrane domain 4320 4338 N/A INTRINSIC
transmembrane domain 4343 4365 N/A INTRINSIC
Pfam:RR_TM4-6 4379 4668 8.4e-76 PFAM
Pfam:Ion_trans 4763 4946 2.8e-15 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000214374
AA Change: L3177P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.8269 question?
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 97.5%
  • 10x: 92.9%
  • 20x: 80.7%
Validation Efficiency 97% (130/134)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a ryanodine receptor found in skeletal muscle. The encoded protein functions as a calcium release channel in the sarcoplasmic reticulum but also serves to connect the sarcoplasmic reticulum and transverse tubule. Mutations in this gene are associated with malignant hyperthermia susceptibility, central core disease, and minicore myopathy with external ophthalmoplegia. Alternatively spliced transcripts encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation and a similar ENU-induced mutation are born with a rounded body shape, edema, thin and misshapened ribs, and abnormal muscle fibers. Mutants die perinatally. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 112 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310030G06Rik G A 9: 50,740,673 T85M probably damaging Het
5430419D17Rik T A 7: 131,244,831 Y777* probably null Het
Actn1 A G 12: 80,172,957 probably benign Het
Afap1l1 A T 18: 61,737,499 S603T probably damaging Het
Ahcy T C 2: 155,068,931 Y39C probably benign Het
Ankmy2 T C 12: 36,186,942 probably null Het
Anxa13 A T 15: 58,348,807 noncoding transcript Het
Aoc1 T C 6: 48,905,786 S221P possibly damaging Het
Arhgef10 C A 8: 14,991,211 A770D possibly damaging Het
Arhgef19 A G 4: 141,254,754 D707G probably benign Het
Arhgef3 G A 14: 27,401,735 R444H probably damaging Het
Asphd1 T C 7: 126,949,099 I11V probably benign Het
Atp2b1 A G 10: 98,994,675 M333V probably benign Het
BC051665 T C 13: 60,785,027 Y40C probably damaging Het
Ccdc87 T A 19: 4,840,313 S278T probably benign Het
Chaf1b G A 16: 93,901,230 G463D possibly damaging Het
Chrna4 T C 2: 181,029,307 T219A possibly damaging Het
Clcnkb T G 4: 141,407,095 T584P possibly damaging Het
Clptm1l T C 13: 73,607,747 S161P probably benign Het
Cmya5 T C 13: 93,094,269 E1437G possibly damaging Het
Col13a1 A T 10: 61,866,426 probably null Het
Col3a1 T C 1: 45,345,968 S82P possibly damaging Het
Cpeb3 A T 19: 37,139,082 M383K probably benign Het
Cr2 T A 1: 195,163,314 H111L probably damaging Het
Cttnbp2 T C 6: 18,375,975 S1522G possibly damaging Het
Cul3 T C 1: 80,282,789 D281G possibly damaging Het
Cyp2c70 T G 19: 40,183,982 K72T probably benign Het
Cyp39a1 A T 17: 43,680,129 I110F probably damaging Het
Cyp46a1 T A 12: 108,351,939 M203K probably null Het
Cyp8b1 A T 9: 121,914,958 V436D possibly damaging Het
Ddx17 T C 15: 79,538,565 D324G probably damaging Het
Dopey2 A G 16: 93,770,153 N1274S probably damaging Het
Dscaml1 G A 9: 45,721,333 V1166I probably benign Het
Dsp T C 13: 38,195,738 V1554A probably damaging Het
Dusp27 C T 1: 166,099,455 V863M possibly damaging Het
Efr3a T A 15: 65,854,792 probably null Het
Egfem1 A T 3: 29,648,271 N223I probably benign Het
Egr2 T C 10: 67,539,975 S147P probably damaging Het
Elmo3 A G 8: 105,308,301 T408A probably benign Het
Flnb A G 14: 7,883,908 D378G probably damaging Het
Foxj2 T A 6: 122,833,261 M193K probably benign Het
Gm6327 A G 16: 12,760,156 noncoding transcript Het
Gm7694 T C 1: 170,302,766 H21R probably benign Het
Gpr107 A G 2: 31,167,025 D43G probably damaging Het
Grid2 T A 6: 64,429,694 Y679* probably null Het
Grin2c G A 11: 115,256,074 P432S possibly damaging Het
H2-M10.1 A G 17: 36,325,733 F60L possibly damaging Het
Hectd4 A G 5: 121,301,878 D1147G possibly damaging Het
Idua G T 5: 108,680,589 A223S probably benign Het
Ifi206 T C 1: 173,486,853 Q7R probably benign Het
Itgad T A 7: 128,203,234 V986E probably damaging Het
Itsn2 G A 12: 4,650,044 R670H probably benign Het
Kdm4a T C 4: 118,138,949 E961G possibly damaging Het
Klra5 T A 6: 129,906,622 I91L probably damaging Het
Kntc1 A G 5: 123,772,113 T525A probably damaging Het
Lct A G 1: 128,294,195 F1536L probably benign Het
Lmod1 T A 1: 135,363,933 D175E probably benign Het
Lonrf1 A C 8: 36,233,972 D361E probably benign Het
Lrrc19 T C 4: 94,638,429 Y297C probably damaging Het
Mast4 T C 13: 102,736,923 E1787G possibly damaging Het
Mpp2 G A 11: 102,060,548 A452V probably benign Het
Msh2 T C 17: 87,718,652 V686A possibly damaging Het
Mthfd1 C T 12: 76,270,419 Q15* probably null Het
Mtnr1b A T 9: 15,863,142 I207N probably damaging Het
Nid2 A G 14: 19,805,412 T1207A probably benign Het
Nin A T 12: 70,038,750 V1569D probably damaging Het
Nov T A 15: 54,749,252 M219K possibly damaging Het
Nrcam T A 12: 44,537,364 probably benign Het
Nsd1 T A 13: 55,246,969 H897Q probably damaging Het
Olfr102 A T 17: 37,313,480 N301K probably benign Het
Olfr1364 T A 13: 21,574,310 I49F possibly damaging Het
Olfr77 G T 9: 19,920,912 K234N probably benign Het
Olfr979 A G 9: 40,001,194 F11S probably benign Het
Paip1 T C 13: 119,451,784 probably benign Het
Pcnx3 G A 19: 5,685,347 R484* probably null Het
Pdxk A G 10: 78,447,980 Y127H probably damaging Het
Phf20 T A 2: 156,287,834 V442E probably benign Het
Phlpp1 G A 1: 106,392,789 D1505N probably damaging Het
Pkhd1 T C 1: 20,347,440 T2496A probably benign Het
Pkhd1l1 A G 15: 44,543,473 T2369A probably benign Het
Plod2 T A 9: 92,603,067 probably benign Het
Pnpla7 T A 2: 25,015,251 M617K possibly damaging Het
Ppp1r16a C T 15: 76,693,669 Q328* probably null Het
Prkch T A 12: 73,649,357 probably null Het
Prr12 G A 7: 45,028,800 H1974Y unknown Het
Prr16 A G 18: 51,302,970 I174V probably benign Het
Prss45 A T 9: 110,838,429 T39S probably benign Het
Pum1 T A 4: 130,718,204 D161E probably damaging Het
Rad51ap2 A G 12: 11,457,112 D345G probably damaging Het
Ralgapb A G 2: 158,446,199 probably benign Het
Rasgrp3 A G 17: 75,500,734 H262R possibly damaging Het
Rnf213 T A 11: 119,436,611 I1809N probably damaging Het
Scyl2 C A 10: 89,650,956 R230L probably damaging Het
Sfxn2 T C 19: 46,582,476 probably benign Het
Slc18b1 T C 10: 23,798,741 probably benign Het
Spata31d1d T C 13: 59,728,191 H510R probably benign Het
Stab1 A T 14: 31,150,823 N1109K probably damaging Het
Sult3a2 A G 10: 33,781,977 S47P probably damaging Het
Tenm3 T C 8: 48,228,993 N2518S possibly damaging Het
Tex21 G T 12: 76,206,891 P416Q probably benign Het
Tex38 T C 4: 115,780,306 N100S probably benign Het
Thsd4 A C 9: 60,394,553 probably benign Het
Ticrr T C 7: 79,681,824 V723A probably damaging Het
Tmprss15 A G 16: 79,090,829 V30A probably benign Het
Uba3 A G 6: 97,185,337 probably benign Het
Ubr1 T C 2: 120,935,319 probably benign Het
Uchl4 A T 9: 64,235,731 I165L probably benign Het
Vmn2r112 A T 17: 22,603,144 T268S possibly damaging Het
Wfdc3 T C 2: 164,744,194 probably benign Het
Zfp282 T A 6: 47,892,867 L282Q probably damaging Het
Zfp422 A T 6: 116,626,784 C85S probably damaging Het
Zfp790 A T 7: 29,828,139 Q83L probably benign Het
Other mutations in Ryr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00321:Ryr1 APN 7 29102810 missense probably damaging 1.00
IGL00335:Ryr1 APN 7 29124960 splice site probably null
IGL00427:Ryr1 APN 7 29104737 splice site probably benign
IGL00559:Ryr1 APN 7 29012242 splice site probably benign
IGL00803:Ryr1 APN 7 29069645 missense possibly damaging 0.95
IGL00886:Ryr1 APN 7 29024229 missense probably damaging 1.00
IGL00948:Ryr1 APN 7 29020195 missense possibly damaging 0.78
IGL01017:Ryr1 APN 7 29082543 missense probably damaging 0.99
IGL01116:Ryr1 APN 7 29100202 splice site probably benign
IGL01385:Ryr1 APN 7 29056985 missense probably damaging 1.00
IGL01482:Ryr1 APN 7 29052337 missense probably damaging 1.00
IGL01529:Ryr1 APN 7 29075227 missense probably damaging 1.00
IGL01543:Ryr1 APN 7 29091076 missense probably damaging 1.00
IGL01653:Ryr1 APN 7 29078597 missense probably damaging 0.99
IGL01701:Ryr1 APN 7 29059810 missense probably damaging 0.98
IGL02051:Ryr1 APN 7 29071658 missense probably benign 0.16
IGL02152:Ryr1 APN 7 29052015 missense possibly damaging 0.95
IGL02271:Ryr1 APN 7 29094047 missense probably benign 0.07
IGL02321:Ryr1 APN 7 29078696 missense probably damaging 1.00
IGL02448:Ryr1 APN 7 29105066 splice site probably benign
IGL02472:Ryr1 APN 7 29040844 missense probably damaging 1.00
IGL02544:Ryr1 APN 7 29115599 missense probably benign 0.24
IGL02666:Ryr1 APN 7 29019763 missense unknown
IGL02672:Ryr1 APN 7 29004519 unclassified probably benign
IGL02677:Ryr1 APN 7 29110608 missense probably benign 0.18
IGL02686:Ryr1 APN 7 29069550 splice site probably benign
IGL02751:Ryr1 APN 7 29078774 missense probably damaging 1.00
IGL02899:Ryr1 APN 7 29048795 missense possibly damaging 0.53
IGL02926:Ryr1 APN 7 29061540 missense probably damaging 1.00
IGL02950:Ryr1 APN 7 29097459 missense probably damaging 1.00
IGL02960:Ryr1 APN 7 29060053 missense probably damaging 1.00
IGL02968:Ryr1 APN 7 29043893 missense probably damaging 1.00
IGL03070:Ryr1 APN 7 29070659 missense probably damaging 1.00
IGL03091:Ryr1 APN 7 29083486 missense possibly damaging 0.85
IGL03100:Ryr1 APN 7 29104593 missense probably damaging 1.00
IGL03107:Ryr1 APN 7 29075199 missense probably damaging 1.00
IGL03117:Ryr1 APN 7 29102964 missense probably damaging 1.00
IGL03118:Ryr1 APN 7 29015786 missense unknown
IGL03146:Ryr1 APN 7 29094032 missense probably benign 0.09
IGL03165:Ryr1 APN 7 29105040 missense probably benign 0.22
IGL03220:Ryr1 APN 7 29059855 missense probably damaging 1.00
R0017:Ryr1 UTSW 7 29047542 missense probably damaging 1.00
R0066:Ryr1 UTSW 7 29005567 unclassified probably benign
R0066:Ryr1 UTSW 7 29005567 unclassified probably benign
R0069:Ryr1 UTSW 7 29110505 splice site probably benign
R0148:Ryr1 UTSW 7 29052035 missense probably damaging 0.99
R0266:Ryr1 UTSW 7 29040679 missense probably damaging 1.00
R0346:Ryr1 UTSW 7 29067588 splice site probably benign
R0387:Ryr1 UTSW 7 29083367 splice site probably benign
R0454:Ryr1 UTSW 7 29036075 missense probably damaging 0.99
R0494:Ryr1 UTSW 7 29003793 splice site probably benign
R0533:Ryr1 UTSW 7 29078780 missense probably damaging 1.00
R0585:Ryr1 UTSW 7 29036076 missense probably damaging 1.00
R0591:Ryr1 UTSW 7 29104795 missense possibly damaging 0.68
R0624:Ryr1 UTSW 7 29074609 missense probably damaging 1.00
R0662:Ryr1 UTSW 7 29100189 missense probably damaging 1.00
R0849:Ryr1 UTSW 7 29040679 missense probably damaging 1.00
R0961:Ryr1 UTSW 7 29009697 missense unknown
R1052:Ryr1 UTSW 7 29096258 missense probably damaging 0.96
R1218:Ryr1 UTSW 7 29086109 missense possibly damaging 0.79
R1340:Ryr1 UTSW 7 29116012 missense probably damaging 0.99
R1513:Ryr1 UTSW 7 29070621 missense probably damaging 1.00
R1543:Ryr1 UTSW 7 29083537 missense possibly damaging 0.67
R1566:Ryr1 UTSW 7 29092175 missense possibly damaging 0.95
R1623:Ryr1 UTSW 7 29095490 missense probably damaging 1.00
R1632:Ryr1 UTSW 7 29094261 missense probably benign 0.03
R1661:Ryr1 UTSW 7 29101738 missense probably damaging 0.98
R1665:Ryr1 UTSW 7 29036078 missense probably damaging 1.00
R1678:Ryr1 UTSW 7 29116154 missense probably damaging 0.99
R1705:Ryr1 UTSW 7 29078564 missense probably damaging 1.00
R1712:Ryr1 UTSW 7 29047503 missense probably benign 0.25
R1720:Ryr1 UTSW 7 29101870 missense probably damaging 0.99
R1799:Ryr1 UTSW 7 29067621 missense probably damaging 1.00
R1847:Ryr1 UTSW 7 29079811 missense probably benign 0.43
R1860:Ryr1 UTSW 7 29009552 missense unknown
R1861:Ryr1 UTSW 7 29009552 missense unknown
R1921:Ryr1 UTSW 7 29054944 missense probably damaging 1.00
R1983:Ryr1 UTSW 7 29059472 missense possibly damaging 0.74
R2043:Ryr1 UTSW 7 29059631 missense probably damaging 0.99
R2089:Ryr1 UTSW 7 29086049 missense probably damaging 1.00
R2091:Ryr1 UTSW 7 29086049 missense probably damaging 1.00
R2091:Ryr1 UTSW 7 29086049 missense probably damaging 1.00
R2105:Ryr1 UTSW 7 29090150 missense probably damaging 0.99
R2175:Ryr1 UTSW 7 29068442 missense probably damaging 1.00
R2259:Ryr1 UTSW 7 29019741 missense unknown
R2291:Ryr1 UTSW 7 29098777 missense probably damaging 1.00
R2351:Ryr1 UTSW 7 29075293 missense probably benign 0.18
R2512:Ryr1 UTSW 7 29103542 missense possibly damaging 0.64
R2571:Ryr1 UTSW 7 29009562 missense unknown
R2571:Ryr1 UTSW 7 29036126 missense possibly damaging 0.94
R2885:Ryr1 UTSW 7 29074798 missense probably damaging 0.99
R2886:Ryr1 UTSW 7 29074798 missense probably damaging 0.99
R2889:Ryr1 UTSW 7 29078741 missense possibly damaging 0.76
R3051:Ryr1 UTSW 7 29053090 missense probably damaging 1.00
R3052:Ryr1 UTSW 7 29053090 missense probably damaging 1.00
R3053:Ryr1 UTSW 7 29053090 missense probably damaging 1.00
R3082:Ryr1 UTSW 7 29045646 missense probably damaging 1.00
R3103:Ryr1 UTSW 7 29074948 missense probably damaging 1.00
R3237:Ryr1 UTSW 7 29069650 critical splice acceptor site probably null
R3551:Ryr1 UTSW 7 29056997 missense probably damaging 1.00
R3552:Ryr1 UTSW 7 29056997 missense probably damaging 1.00
R3807:Ryr1 UTSW 7 29020152 missense probably damaging 1.00
R3815:Ryr1 UTSW 7 29072902 missense probably damaging 0.98
R4010:Ryr1 UTSW 7 29095124 missense probably benign 0.41
R4041:Ryr1 UTSW 7 29085931 missense possibly damaging 0.77
R4226:Ryr1 UTSW 7 29062151 nonsense probably null
R4257:Ryr1 UTSW 7 29082450 missense possibly damaging 0.93
R4328:Ryr1 UTSW 7 29083059 missense probably damaging 1.00
R4394:Ryr1 UTSW 7 29094242 missense possibly damaging 0.69
R4485:Ryr1 UTSW 7 29090156 missense probably damaging 0.97
R4550:Ryr1 UTSW 7 29098735 missense probably benign 0.05
R4554:Ryr1 UTSW 7 29105008 missense probably benign 0.03
R4562:Ryr1 UTSW 7 29074580 intron probably benign
R4642:Ryr1 UTSW 7 29086038 missense possibly damaging 0.91
R4669:Ryr1 UTSW 7 29059831 missense probably null 0.99
R4707:Ryr1 UTSW 7 29045662 missense probably damaging 1.00
R4766:Ryr1 UTSW 7 29085833 missense probably damaging 0.96
R4768:Ryr1 UTSW 7 29004821 unclassified probably benign
R4770:Ryr1 UTSW 7 29109282 missense probably damaging 0.99
R4780:Ryr1 UTSW 7 29095097 missense possibly damaging 0.85
R4927:Ryr1 UTSW 7 29019983 missense unknown
R4933:Ryr1 UTSW 7 29104298 missense probably damaging 1.00
R4934:Ryr1 UTSW 7 29068095 missense probably damaging 1.00
R4942:Ryr1 UTSW 7 29069573 missense probably damaging 0.98
R4960:Ryr1 UTSW 7 29078783 missense possibly damaging 0.82
R5007:Ryr1 UTSW 7 29069115 missense probably damaging 1.00
R5011:Ryr1 UTSW 7 29102809 splice site probably null
R5013:Ryr1 UTSW 7 29102809 splice site probably null
R5137:Ryr1 UTSW 7 29101858 missense possibly damaging 0.94
R5167:Ryr1 UTSW 7 29067693 missense probably damaging 1.00
R5239:Ryr1 UTSW 7 29036128 missense probably damaging 1.00
R5291:Ryr1 UTSW 7 29115598 missense probably benign 0.03
R5303:Ryr1 UTSW 7 29068482 missense probably damaging 1.00
R5386:Ryr1 UTSW 7 29117416 missense probably damaging 0.98
R5431:Ryr1 UTSW 7 29109812 missense probably benign 0.39
R5460:Ryr1 UTSW 7 29071961 missense probably damaging 1.00
R5463:Ryr1 UTSW 7 29024023 missense possibly damaging 0.79
R5503:Ryr1 UTSW 7 29069028 missense possibly damaging 0.87
R5541:Ryr1 UTSW 7 29086185 missense probably damaging 1.00
R5573:Ryr1 UTSW 7 29015723 missense unknown
R5575:Ryr1 UTSW 7 29078693 missense possibly damaging 0.77
R5610:Ryr1 UTSW 7 29111974 missense probably benign 0.05
R5658:Ryr1 UTSW 7 29091089 splice site probably null
R5918:Ryr1 UTSW 7 29009152 missense probably benign 0.39
R5926:Ryr1 UTSW 7 29104360 missense probably damaging 1.00
R5938:Ryr1 UTSW 7 29046865 missense probably damaging 1.00
R5939:Ryr1 UTSW 7 29116127 missense probably damaging 0.97
R5947:Ryr1 UTSW 7 29071924 missense probably null 0.98
R5991:Ryr1 UTSW 7 29104610 missense probably damaging 0.99
R5992:Ryr1 UTSW 7 29067637 missense probably damaging 1.00
R5996:Ryr1 UTSW 7 29024241 missense probably benign 0.38
R6075:Ryr1 UTSW 7 29087438 missense probably damaging 1.00
R6091:Ryr1 UTSW 7 29071973 missense probably benign 0.01
R6126:Ryr1 UTSW 7 29076239 missense probably null 1.00
R6147:Ryr1 UTSW 7 29085914 missense possibly damaging 0.88
R6235:Ryr1 UTSW 7 29116181 missense probably benign 0.07
R6279:Ryr1 UTSW 7 29087428 missense possibly damaging 0.93
R6381:Ryr1 UTSW 7 29075257 missense possibly damaging 0.87
R6441:Ryr1 UTSW 7 29059695 missense possibly damaging 0.95
R6443:Ryr1 UTSW 7 29077078 missense probably damaging 0.97
R6459:Ryr1 UTSW 7 29015654 missense probably benign 0.39
R6514:Ryr1 UTSW 7 29046841 missense probably damaging 1.00
R6563:Ryr1 UTSW 7 29095492 missense possibly damaging 0.92
R6660:Ryr1 UTSW 7 29038345 critical splice donor site probably null
R6746:Ryr1 UTSW 7 29117404 missense possibly damaging 0.56
R6785:Ryr1 UTSW 7 29064874 missense probably benign 0.12
R6800:Ryr1 UTSW 7 29024316 missense possibly damaging 0.95
R6939:Ryr1 UTSW 7 29052326 missense possibly damaging 0.91
R6980:Ryr1 UTSW 7 29109387 missense probably benign 0.03
R6995:Ryr1 UTSW 7 29094182 missense probably damaging 0.97
R7065:Ryr1 UTSW 7 29103643 missense probably damaging 1.00
R7123:Ryr1 UTSW 7 29046854 missense probably benign 0.37
R7238:Ryr1 UTSW 7 29095382 missense probably benign 0.24
R7240:Ryr1 UTSW 7 29052015 missense possibly damaging 0.95
R7300:Ryr1 UTSW 7 29059511 missense probably damaging 1.00
R7365:Ryr1 UTSW 7 29085755 missense probably benign 0.05
R7403:Ryr1 UTSW 7 29013867 missense probably benign 0.34
R7422:Ryr1 UTSW 7 29085870 missense probably benign 0.00
R7493:Ryr1 UTSW 7 29095205 missense probably benign 0.44
R7570:Ryr1 UTSW 7 29078585 missense probably damaging 0.98
R7593:Ryr1 UTSW 7 29036103 missense probably damaging 1.00
R7769:Ryr1 UTSW 7 29098785 missense probably damaging 1.00
R7781:Ryr1 UTSW 7 29067630 missense probably damaging 1.00
R7790:Ryr1 UTSW 7 29104832 missense probably benign 0.39
R7799:Ryr1 UTSW 7 29003560 splice site probably null
R7997:Ryr1 UTSW 7 29003543 missense unknown
R8052:Ryr1 UTSW 7 29083385 missense probably benign 0.05
R8096:Ryr1 UTSW 7 29009201 missense unknown
R8116:Ryr1 UTSW 7 29110883 missense probably benign 0.03
X0021:Ryr1 UTSW 7 29061531 missense probably damaging 1.00
Z1176:Ryr1 UTSW 7 29020214 missense probably damaging 1.00
Z1176:Ryr1 UTSW 7 29086035 missense probably benign 0.10
Z1176:Ryr1 UTSW 7 29103498 missense probably damaging 1.00
Z1177:Ryr1 UTSW 7 29017985 missense unknown
Z1177:Ryr1 UTSW 7 29048792 nonsense probably null
Z1177:Ryr1 UTSW 7 29101922 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GATTTTAATATGTCCAGCTTTGCACCCC -3'
(R):5'- AGTCCCTCCCGCTTATAGTAAGCC -3'

Sequencing Primer
(F):5'- CCTCCCCACTTCACATGC -3'
(R):5'- ccaacctctacccccactc -3'
Posted On2014-04-13