Mutagenetix > Incidental Mutation

Incidental Mutation 'R1572:Ryr1'

170843

Institutional Source

Beutler Lab

Gene Symbol

Ryr1

Ensembl Gene

ENSMUSG00000030592

Gene Name

ryanodine receptor 1, skeletal muscle

Synonyms

skrr, calcium release channel isoform 1, Ryr

MMRRC Submission

039611-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R1572 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

29003344-29125179 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 29062191 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Proline at position 3177 (L3177P)

Ref Sequence

ENSEMBL: ENSMUSP00000149042 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000032813] [ENSMUST00000179893] [ENSMUST00000214374]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000032813
AA Change: L3170P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000032813
Gene: ENSMUSG00000030592
AA Change: L3170P

Domain	Start	End	E-Value	Type
low complexity region	2	11	N/A	INTRINSIC
MIR	99	154	7.52e-4	SMART
MIR	161	206	1.11e-6	SMART
MIR	212	266	1.23e-8	SMART
MIR	272	362	1.05e-25	SMART
Pfam:RYDR_ITPR	441	645	1.2e-73	PFAM
SPRY	660	798	2.79e-27	SMART
Pfam:RyR	851	945	6.5e-33	PFAM
Pfam:RyR	965	1059	1.5e-30	PFAM
SPRY	1086	1209	8.62e-42	SMART
low complexity region	1318	1332	N/A	INTRINSIC
low complexity region	1340	1349	N/A	INTRINSIC
SPRY	1431	1571	3.05e-33	SMART
low complexity region	1787	1798	N/A	INTRINSIC
coiled coil region	1871	1932	N/A	INTRINSIC
low complexity region	1989	1998	N/A	INTRINSIC
low complexity region	2048	2057	N/A	INTRINSIC
low complexity region	2069	2092	N/A	INTRINSIC
Pfam:RYDR_ITPR	2158	2366	7e-66	PFAM
low complexity region	2390	2404	N/A	INTRINSIC
Pfam:RyR	2735	2829	9.7e-34	PFAM
Pfam:RyR	2855	2943	5.7e-32	PFAM
low complexity region	3130	3144	N/A	INTRINSIC
low complexity region	3290	3304	N/A	INTRINSIC
low complexity region	3375	3394	N/A	INTRINSIC
PDB:2BCX\|B	3613	3642	2e-13	PDB
low complexity region	3681	3691	N/A	INTRINSIC
low complexity region	3735	3760	N/A	INTRINSIC
Pfam:RIH_assoc	3872	4004	1.9e-41	PFAM
low complexity region	4010	4023	N/A	INTRINSIC
Pfam:EF-hand_8	4085	4136	9.8e-8	PFAM
transmembrane domain	4283	4305	N/A	INTRINSIC
transmembrane domain	4318	4336	N/A	INTRINSIC
transmembrane domain	4341	4363	N/A	INTRINSIC
Pfam:RR_TM4-6	4377	4666	2e-86	PFAM
Pfam:Ion_trans	4761	4932	3.4e-10	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000179893
AA Change: L3170P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000137123
Gene: ENSMUSG00000030592
AA Change: L3170P

Domain	Start	End	E-Value	Type
low complexity region	2	11	N/A	INTRINSIC
MIR	99	154	7.52e-4	SMART
MIR	161	206	1.11e-6	SMART
MIR	212	266	1.23e-8	SMART
MIR	272	362	1.05e-25	SMART
Pfam:RYDR_ITPR	443	638	4.5e-63	PFAM
SPRY	660	798	2.79e-27	SMART
Pfam:RyR	852	942	1.3e-37	PFAM
Pfam:RyR	966	1056	1.6e-28	PFAM
SPRY	1086	1209	8.62e-42	SMART
low complexity region	1318	1332	N/A	INTRINSIC
low complexity region	1340	1349	N/A	INTRINSIC
SPRY	1431	1571	3.05e-33	SMART
low complexity region	1787	1798	N/A	INTRINSIC
coiled coil region	1871	1932	N/A	INTRINSIC
low complexity region	1989	1998	N/A	INTRINSIC
low complexity region	2048	2057	N/A	INTRINSIC
low complexity region	2069	2092	N/A	INTRINSIC
Pfam:RYDR_ITPR	2160	2366	2.2e-68	PFAM
low complexity region	2390	2404	N/A	INTRINSIC
Pfam:RyR	2736	2826	7.2e-31	PFAM
Pfam:RyR	2856	2940	5.6e-27	PFAM
low complexity region	3130	3144	N/A	INTRINSIC
low complexity region	3290	3304	N/A	INTRINSIC
low complexity region	3375	3394	N/A	INTRINSIC
PDB:2BCX\|B	3615	3644	2e-13	PDB
low complexity region	3683	3693	N/A	INTRINSIC
low complexity region	3737	3762	N/A	INTRINSIC
Pfam:RIH_assoc	3878	3996	6.2e-35	PFAM
low complexity region	4012	4025	N/A	INTRINSIC
Pfam:EF-hand_8	4087	4137	1.8e-8	PFAM
transmembrane domain	4285	4307	N/A	INTRINSIC
transmembrane domain	4320	4338	N/A	INTRINSIC
transmembrane domain	4343	4365	N/A	INTRINSIC
Pfam:RR_TM4-6	4379	4668	8.4e-76	PFAM
Pfam:Ion_trans	4763	4946	2.8e-15	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000214374
AA Change: L3177P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Meta Mutation Damage Score

0.8269

Coding Region Coverage

1x: 98.7%
3x: 97.5%
10x: 92.9%
20x: 80.7%

Validation Efficiency

97% (130/134)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a ryanodine receptor found in skeletal muscle. The encoded protein functions as a calcium release channel in the sarcoplasmic reticulum but also serves to connect the sarcoplasmic reticulum and transverse tubule. Mutations in this gene are associated with malignant hyperthermia susceptibility, central core disease, and minicore myopathy with external ophthalmoplegia. Alternatively spliced transcripts encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation and a similar ENU-induced mutation are born with a rounded body shape, edema, thin and misshapened ribs, and abnormal muscle fibers. Mutants die perinatally. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 112 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310030G06Rik	G	A	9: 50,740,673	T85M	probably damaging	Het
5430419D17Rik	T	A	7: 131,244,831	Y777*	probably null	Het
Actn1	A	G	12: 80,172,957		probably benign	Het
Afap1l1	A	T	18: 61,737,499	S603T	probably damaging	Het
Ahcy	T	C	2: 155,068,931	Y39C	probably benign	Het
Ankmy2	T	C	12: 36,186,942		probably null	Het
Anxa13	A	T	15: 58,348,807		noncoding transcript	Het
Aoc1	T	C	6: 48,905,786	S221P	possibly damaging	Het
Arhgef10	C	A	8: 14,991,211	A770D	possibly damaging	Het
Arhgef19	A	G	4: 141,254,754	D707G	probably benign	Het
Arhgef3	G	A	14: 27,401,735	R444H	probably damaging	Het
Asphd1	T	C	7: 126,949,099	I11V	probably benign	Het
Atp2b1	A	G	10: 98,994,675	M333V	probably benign	Het
BC051665	T	C	13: 60,785,027	Y40C	probably damaging	Het
Ccdc87	T	A	19: 4,840,313	S278T	probably benign	Het
Chaf1b	G	A	16: 93,901,230	G463D	possibly damaging	Het
Chrna4	T	C	2: 181,029,307	T219A	possibly damaging	Het
Clcnkb	T	G	4: 141,407,095	T584P	possibly damaging	Het
Clptm1l	T	C	13: 73,607,747	S161P	probably benign	Het
Cmya5	T	C	13: 93,094,269	E1437G	possibly damaging	Het
Col13a1	A	T	10: 61,866,426		probably null	Het
Col3a1	T	C	1: 45,345,968	S82P	possibly damaging	Het
Cpeb3	A	T	19: 37,139,082	M383K	probably benign	Het
Cr2	T	A	1: 195,163,314	H111L	probably damaging	Het
Cttnbp2	T	C	6: 18,375,975	S1522G	possibly damaging	Het
Cul3	T	C	1: 80,282,789	D281G	possibly damaging	Het
Cyp2c70	T	G	19: 40,183,982	K72T	probably benign	Het
Cyp39a1	A	T	17: 43,680,129	I110F	probably damaging	Het
Cyp46a1	T	A	12: 108,351,939	M203K	probably null	Het
Cyp8b1	A	T	9: 121,914,958	V436D	possibly damaging	Het
Ddx17	T	C	15: 79,538,565	D324G	probably damaging	Het
Dopey2	A	G	16: 93,770,153	N1274S	probably damaging	Het
Dscaml1	G	A	9: 45,721,333	V1166I	probably benign	Het
Dsp	T	C	13: 38,195,738	V1554A	probably damaging	Het
Dusp27	C	T	1: 166,099,455	V863M	possibly damaging	Het
Efr3a	T	A	15: 65,854,792		probably null	Het
Egfem1	A	T	3: 29,648,271	N223I	probably benign	Het
Egr2	T	C	10: 67,539,975	S147P	probably damaging	Het
Elmo3	A	G	8: 105,308,301	T408A	probably benign	Het
Flnb	A	G	14: 7,883,908	D378G	probably damaging	Het
Foxj2	T	A	6: 122,833,261	M193K	probably benign	Het
Gm6327	A	G	16: 12,760,156		noncoding transcript	Het
Gm7694	T	C	1: 170,302,766	H21R	probably benign	Het
Gpr107	A	G	2: 31,167,025	D43G	probably damaging	Het
Grid2	T	A	6: 64,429,694	Y679*	probably null	Het
Grin2c	G	A	11: 115,256,074	P432S	possibly damaging	Het
H2-M10.1	A	G	17: 36,325,733	F60L	possibly damaging	Het
Hectd4	A	G	5: 121,301,878	D1147G	possibly damaging	Het
Idua	G	T	5: 108,680,589	A223S	probably benign	Het
Ifi206	T	C	1: 173,486,853	Q7R	probably benign	Het
Itgad	T	A	7: 128,203,234	V986E	probably damaging	Het
Itsn2	G	A	12: 4,650,044	R670H	probably benign	Het
Kdm4a	T	C	4: 118,138,949	E961G	possibly damaging	Het
Klra5	T	A	6: 129,906,622	I91L	probably damaging	Het
Kntc1	A	G	5: 123,772,113	T525A	probably damaging	Het
Lct	A	G	1: 128,294,195	F1536L	probably benign	Het
Lmod1	T	A	1: 135,363,933	D175E	probably benign	Het
Lonrf1	A	C	8: 36,233,972	D361E	probably benign	Het
Lrrc19	T	C	4: 94,638,429	Y297C	probably damaging	Het
Mast4	T	C	13: 102,736,923	E1787G	possibly damaging	Het
Mpp2	G	A	11: 102,060,548	A452V	probably benign	Het
Msh2	T	C	17: 87,718,652	V686A	possibly damaging	Het
Mthfd1	C	T	12: 76,270,419	Q15*	probably null	Het
Mtnr1b	A	T	9: 15,863,142	I207N	probably damaging	Het
Nid2	A	G	14: 19,805,412	T1207A	probably benign	Het
Nin	A	T	12: 70,038,750	V1569D	probably damaging	Het
Nov	T	A	15: 54,749,252	M219K	possibly damaging	Het
Nrcam	T	A	12: 44,537,364		probably benign	Het
Nsd1	T	A	13: 55,246,969	H897Q	probably damaging	Het
Olfr102	A	T	17: 37,313,480	N301K	probably benign	Het
Olfr1364	T	A	13: 21,574,310	I49F	possibly damaging	Het
Olfr77	G	T	9: 19,920,912	K234N	probably benign	Het
Olfr979	A	G	9: 40,001,194	F11S	probably benign	Het
Paip1	T	C	13: 119,451,784		probably benign	Het
Pcnx3	G	A	19: 5,685,347	R484*	probably null	Het
Pdxk	A	G	10: 78,447,980	Y127H	probably damaging	Het
Phf20	T	A	2: 156,287,834	V442E	probably benign	Het
Phlpp1	G	A	1: 106,392,789	D1505N	probably damaging	Het
Pkhd1	T	C	1: 20,347,440	T2496A	probably benign	Het
Pkhd1l1	A	G	15: 44,543,473	T2369A	probably benign	Het
Plod2	T	A	9: 92,603,067		probably benign	Het
Pnpla7	T	A	2: 25,015,251	M617K	possibly damaging	Het
Ppp1r16a	C	T	15: 76,693,669	Q328*	probably null	Het
Prkch	T	A	12: 73,649,357		probably null	Het
Prr12	G	A	7: 45,028,800	H1974Y	unknown	Het
Prr16	A	G	18: 51,302,970	I174V	probably benign	Het
Prss45	A	T	9: 110,838,429	T39S	probably benign	Het
Pum1	T	A	4: 130,718,204	D161E	probably damaging	Het
Rad51ap2	A	G	12: 11,457,112	D345G	probably damaging	Het
Ralgapb	A	G	2: 158,446,199		probably benign	Het
Rasgrp3	A	G	17: 75,500,734	H262R	possibly damaging	Het
Rnf213	T	A	11: 119,436,611	I1809N	probably damaging	Het
Scyl2	C	A	10: 89,650,956	R230L	probably damaging	Het
Sfxn2	T	C	19: 46,582,476		probably benign	Het
Slc18b1	T	C	10: 23,798,741		probably benign	Het
Spata31d1d	T	C	13: 59,728,191	H510R	probably benign	Het
Stab1	A	T	14: 31,150,823	N1109K	probably damaging	Het
Sult3a2	A	G	10: 33,781,977	S47P	probably damaging	Het
Tenm3	T	C	8: 48,228,993	N2518S	possibly damaging	Het
Tex21	G	T	12: 76,206,891	P416Q	probably benign	Het
Tex38	T	C	4: 115,780,306	N100S	probably benign	Het
Thsd4	A	C	9: 60,394,553		probably benign	Het
Ticrr	T	C	7: 79,681,824	V723A	probably damaging	Het
Tmprss15	A	G	16: 79,090,829	V30A	probably benign	Het
Uba3	A	G	6: 97,185,337		probably benign	Het
Ubr1	T	C	2: 120,935,319		probably benign	Het
Uchl4	A	T	9: 64,235,731	I165L	probably benign	Het
Vmn2r112	A	T	17: 22,603,144	T268S	possibly damaging	Het
Wfdc3	T	C	2: 164,744,194		probably benign	Het
Zfp282	T	A	6: 47,892,867	L282Q	probably damaging	Het
Zfp422	A	T	6: 116,626,784	C85S	probably damaging	Het
Zfp790	A	T	7: 29,828,139	Q83L	probably benign	Het

Other mutations in Ryr1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00321:Ryr1	APN	7	29102810	missense	probably damaging	1.00
IGL00335:Ryr1	APN	7	29124960	splice site	probably null
IGL00427:Ryr1	APN	7	29104737	splice site	probably benign
IGL00559:Ryr1	APN	7	29012242	splice site	probably benign
IGL00803:Ryr1	APN	7	29069645	missense	possibly damaging	0.95
IGL00886:Ryr1	APN	7	29024229	missense	probably damaging	1.00
IGL00948:Ryr1	APN	7	29020195	missense	possibly damaging	0.78
IGL01017:Ryr1	APN	7	29082543	missense	probably damaging	0.99
IGL01116:Ryr1	APN	7	29100202	splice site	probably benign
IGL01385:Ryr1	APN	7	29056985	missense	probably damaging	1.00
IGL01482:Ryr1	APN	7	29052337	missense	probably damaging	1.00
IGL01529:Ryr1	APN	7	29075227	missense	probably damaging	1.00
IGL01543:Ryr1	APN	7	29091076	missense	probably damaging	1.00
IGL01653:Ryr1	APN	7	29078597	missense	probably damaging	0.99
IGL01701:Ryr1	APN	7	29059810	missense	probably damaging	0.98
IGL02051:Ryr1	APN	7	29071658	missense	probably benign	0.16
IGL02152:Ryr1	APN	7	29052015	missense	possibly damaging	0.95
IGL02271:Ryr1	APN	7	29094047	missense	probably benign	0.07
IGL02321:Ryr1	APN	7	29078696	missense	probably damaging	1.00
IGL02448:Ryr1	APN	7	29105066	splice site	probably benign
IGL02472:Ryr1	APN	7	29040844	missense	probably damaging	1.00
IGL02544:Ryr1	APN	7	29115599	missense	probably benign	0.24
IGL02666:Ryr1	APN	7	29019763	missense	unknown
IGL02672:Ryr1	APN	7	29004519	unclassified	probably benign
IGL02677:Ryr1	APN	7	29110608	missense	probably benign	0.18
IGL02686:Ryr1	APN	7	29069550	splice site	probably benign
IGL02751:Ryr1	APN	7	29078774	missense	probably damaging	1.00
IGL02899:Ryr1	APN	7	29048795	missense	possibly damaging	0.53
IGL02926:Ryr1	APN	7	29061540	missense	probably damaging	1.00
IGL02950:Ryr1	APN	7	29097459	missense	probably damaging	1.00
IGL02960:Ryr1	APN	7	29060053	missense	probably damaging	1.00
IGL02968:Ryr1	APN	7	29043893	missense	probably damaging	1.00
IGL03070:Ryr1	APN	7	29070659	missense	probably damaging	1.00
IGL03091:Ryr1	APN	7	29083486	missense	possibly damaging	0.85
IGL03100:Ryr1	APN	7	29104593	missense	probably damaging	1.00
IGL03107:Ryr1	APN	7	29075199	missense	probably damaging	1.00
IGL03117:Ryr1	APN	7	29102964	missense	probably damaging	1.00
IGL03118:Ryr1	APN	7	29015786	missense	unknown
IGL03146:Ryr1	APN	7	29094032	missense	probably benign	0.09
IGL03165:Ryr1	APN	7	29105040	missense	probably benign	0.22
IGL03220:Ryr1	APN	7	29059855	missense	probably damaging	1.00
R0017:Ryr1	UTSW	7	29047542	missense	probably damaging	1.00
R0066:Ryr1	UTSW	7	29005567	unclassified	probably benign
R0066:Ryr1	UTSW	7	29005567	unclassified	probably benign
R0069:Ryr1	UTSW	7	29110505	splice site	probably benign
R0148:Ryr1	UTSW	7	29052035	missense	probably damaging	0.99
R0266:Ryr1	UTSW	7	29040679	missense	probably damaging	1.00
R0346:Ryr1	UTSW	7	29067588	splice site	probably benign
R0387:Ryr1	UTSW	7	29083367	splice site	probably benign
R0454:Ryr1	UTSW	7	29036075	missense	probably damaging	0.99
R0494:Ryr1	UTSW	7	29003793	splice site	probably benign
R0533:Ryr1	UTSW	7	29078780	missense	probably damaging	1.00
R0585:Ryr1	UTSW	7	29036076	missense	probably damaging	1.00
R0591:Ryr1	UTSW	7	29104795	missense	possibly damaging	0.68
R0624:Ryr1	UTSW	7	29074609	missense	probably damaging	1.00
R0662:Ryr1	UTSW	7	29100189	missense	probably damaging	1.00
R0849:Ryr1	UTSW	7	29040679	missense	probably damaging	1.00
R0961:Ryr1	UTSW	7	29009697	missense	unknown
R1052:Ryr1	UTSW	7	29096258	missense	probably damaging	0.96
R1218:Ryr1	UTSW	7	29086109	missense	possibly damaging	0.79
R1340:Ryr1	UTSW	7	29116012	missense	probably damaging	0.99
R1513:Ryr1	UTSW	7	29070621	missense	probably damaging	1.00
R1543:Ryr1	UTSW	7	29083537	missense	possibly damaging	0.67
R1566:Ryr1	UTSW	7	29092175	missense	possibly damaging	0.95
R1623:Ryr1	UTSW	7	29095490	missense	probably damaging	1.00
R1632:Ryr1	UTSW	7	29094261	missense	probably benign	0.03
R1661:Ryr1	UTSW	7	29101738	missense	probably damaging	0.98
R1665:Ryr1	UTSW	7	29036078	missense	probably damaging	1.00
R1678:Ryr1	UTSW	7	29116154	missense	probably damaging	0.99
R1705:Ryr1	UTSW	7	29078564	missense	probably damaging	1.00
R1712:Ryr1	UTSW	7	29047503	missense	probably benign	0.25
R1720:Ryr1	UTSW	7	29101870	missense	probably damaging	0.99
R1799:Ryr1	UTSW	7	29067621	missense	probably damaging	1.00
R1847:Ryr1	UTSW	7	29079811	missense	probably benign	0.43
R1860:Ryr1	UTSW	7	29009552	missense	unknown
R1861:Ryr1	UTSW	7	29009552	missense	unknown
R1921:Ryr1	UTSW	7	29054944	missense	probably damaging	1.00
R1983:Ryr1	UTSW	7	29059472	missense	possibly damaging	0.74
R2043:Ryr1	UTSW	7	29059631	missense	probably damaging	0.99
R2089:Ryr1	UTSW	7	29086049	missense	probably damaging	1.00
R2091:Ryr1	UTSW	7	29086049	missense	probably damaging	1.00
R2091:Ryr1	UTSW	7	29086049	missense	probably damaging	1.00
R2105:Ryr1	UTSW	7	29090150	missense	probably damaging	0.99
R2175:Ryr1	UTSW	7	29068442	missense	probably damaging	1.00
R2259:Ryr1	UTSW	7	29019741	missense	unknown
R2291:Ryr1	UTSW	7	29098777	missense	probably damaging	1.00
R2351:Ryr1	UTSW	7	29075293	missense	probably benign	0.18
R2512:Ryr1	UTSW	7	29103542	missense	possibly damaging	0.64
R2571:Ryr1	UTSW	7	29009562	missense	unknown
R2571:Ryr1	UTSW	7	29036126	missense	possibly damaging	0.94
R2885:Ryr1	UTSW	7	29074798	missense	probably damaging	0.99
R2886:Ryr1	UTSW	7	29074798	missense	probably damaging	0.99
R2889:Ryr1	UTSW	7	29078741	missense	possibly damaging	0.76
R3051:Ryr1	UTSW	7	29053090	missense	probably damaging	1.00
R3052:Ryr1	UTSW	7	29053090	missense	probably damaging	1.00
R3053:Ryr1	UTSW	7	29053090	missense	probably damaging	1.00
R3082:Ryr1	UTSW	7	29045646	missense	probably damaging	1.00
R3103:Ryr1	UTSW	7	29074948	missense	probably damaging	1.00
R3237:Ryr1	UTSW	7	29069650	critical splice acceptor site	probably null
R3551:Ryr1	UTSW	7	29056997	missense	probably damaging	1.00
R3552:Ryr1	UTSW	7	29056997	missense	probably damaging	1.00
R3807:Ryr1	UTSW	7	29020152	missense	probably damaging	1.00
R3815:Ryr1	UTSW	7	29072902	missense	probably damaging	0.98
R4010:Ryr1	UTSW	7	29095124	missense	probably benign	0.41
R4041:Ryr1	UTSW	7	29085931	missense	possibly damaging	0.77
R4226:Ryr1	UTSW	7	29062151	nonsense	probably null
R4257:Ryr1	UTSW	7	29082450	missense	possibly damaging	0.93
R4328:Ryr1	UTSW	7	29083059	missense	probably damaging	1.00
R4394:Ryr1	UTSW	7	29094242	missense	possibly damaging	0.69
R4485:Ryr1	UTSW	7	29090156	missense	probably damaging	0.97
R4550:Ryr1	UTSW	7	29098735	missense	probably benign	0.05
R4554:Ryr1	UTSW	7	29105008	missense	probably benign	0.03
R4562:Ryr1	UTSW	7	29074580	intron	probably benign
R4642:Ryr1	UTSW	7	29086038	missense	possibly damaging	0.91
R4669:Ryr1	UTSW	7	29059831	missense	probably null	0.99
R4707:Ryr1	UTSW	7	29045662	missense	probably damaging	1.00
R4766:Ryr1	UTSW	7	29085833	missense	probably damaging	0.96
R4768:Ryr1	UTSW	7	29004821	unclassified	probably benign
R4770:Ryr1	UTSW	7	29109282	missense	probably damaging	0.99
R4780:Ryr1	UTSW	7	29095097	missense	possibly damaging	0.85
R4927:Ryr1	UTSW	7	29019983	missense	unknown
R4933:Ryr1	UTSW	7	29104298	missense	probably damaging	1.00
R4934:Ryr1	UTSW	7	29068095	missense	probably damaging	1.00
R4942:Ryr1	UTSW	7	29069573	missense	probably damaging	0.98
R4960:Ryr1	UTSW	7	29078783	missense	possibly damaging	0.82
R5007:Ryr1	UTSW	7	29069115	missense	probably damaging	1.00
R5011:Ryr1	UTSW	7	29102809	splice site	probably null
R5013:Ryr1	UTSW	7	29102809	splice site	probably null
R5137:Ryr1	UTSW	7	29101858	missense	possibly damaging	0.94
R5167:Ryr1	UTSW	7	29067693	missense	probably damaging	1.00
R5239:Ryr1	UTSW	7	29036128	missense	probably damaging	1.00
R5291:Ryr1	UTSW	7	29115598	missense	probably benign	0.03
R5303:Ryr1	UTSW	7	29068482	missense	probably damaging	1.00
R5386:Ryr1	UTSW	7	29117416	missense	probably damaging	0.98
R5431:Ryr1	UTSW	7	29109812	missense	probably benign	0.39
R5460:Ryr1	UTSW	7	29071961	missense	probably damaging	1.00
R5463:Ryr1	UTSW	7	29024023	missense	possibly damaging	0.79
R5503:Ryr1	UTSW	7	29069028	missense	possibly damaging	0.87
R5541:Ryr1	UTSW	7	29086185	missense	probably damaging	1.00
R5573:Ryr1	UTSW	7	29015723	missense	unknown
R5575:Ryr1	UTSW	7	29078693	missense	possibly damaging	0.77
R5610:Ryr1	UTSW	7	29111974	missense	probably benign	0.05
R5658:Ryr1	UTSW	7	29091089	splice site	probably null
R5918:Ryr1	UTSW	7	29009152	missense	probably benign	0.39
R5926:Ryr1	UTSW	7	29104360	missense	probably damaging	1.00
R5938:Ryr1	UTSW	7	29046865	missense	probably damaging	1.00
R5939:Ryr1	UTSW	7	29116127	missense	probably damaging	0.97
R5947:Ryr1	UTSW	7	29071924	missense	probably null	0.98
R5991:Ryr1	UTSW	7	29104610	missense	probably damaging	0.99
R5992:Ryr1	UTSW	7	29067637	missense	probably damaging	1.00
R5996:Ryr1	UTSW	7	29024241	missense	probably benign	0.38
R6075:Ryr1	UTSW	7	29087438	missense	probably damaging	1.00
R6091:Ryr1	UTSW	7	29071973	missense	probably benign	0.01
R6126:Ryr1	UTSW	7	29076239	missense	probably null	1.00
R6147:Ryr1	UTSW	7	29085914	missense	possibly damaging	0.88
R6235:Ryr1	UTSW	7	29116181	missense	probably benign	0.07
R6279:Ryr1	UTSW	7	29087428	missense	possibly damaging	0.93
R6381:Ryr1	UTSW	7	29075257	missense	possibly damaging	0.87
R6441:Ryr1	UTSW	7	29059695	missense	possibly damaging	0.95
R6443:Ryr1	UTSW	7	29077078	missense	probably damaging	0.97
R6459:Ryr1	UTSW	7	29015654	missense	probably benign	0.39
R6514:Ryr1	UTSW	7	29046841	missense	probably damaging	1.00
R6563:Ryr1	UTSW	7	29095492	missense	possibly damaging	0.92
R6660:Ryr1	UTSW	7	29038345	critical splice donor site	probably null
R6746:Ryr1	UTSW	7	29117404	missense	possibly damaging	0.56
R6785:Ryr1	UTSW	7	29064874	missense	probably benign	0.12
R6800:Ryr1	UTSW	7	29024316	missense	possibly damaging	0.95
R6939:Ryr1	UTSW	7	29052326	missense	possibly damaging	0.91
R6980:Ryr1	UTSW	7	29109387	missense	probably benign	0.03
R6995:Ryr1	UTSW	7	29094182	missense	probably damaging	0.97
R7065:Ryr1	UTSW	7	29103643	missense	probably damaging	1.00
R7123:Ryr1	UTSW	7	29046854	missense	probably benign	0.37
R7238:Ryr1	UTSW	7	29095382	missense	probably benign	0.24
R7240:Ryr1	UTSW	7	29052015	missense	possibly damaging	0.95
R7300:Ryr1	UTSW	7	29059511	missense	probably damaging	1.00
R7365:Ryr1	UTSW	7	29085755	missense	probably benign	0.05
R7403:Ryr1	UTSW	7	29013867	missense	probably benign	0.34
R7422:Ryr1	UTSW	7	29085870	missense	probably benign	0.00
R7493:Ryr1	UTSW	7	29095205	missense	probably benign	0.44
R7570:Ryr1	UTSW	7	29078585	missense	probably damaging	0.98
R7593:Ryr1	UTSW	7	29036103	missense	probably damaging	1.00
R7769:Ryr1	UTSW	7	29098785	missense	probably damaging	1.00
R7781:Ryr1	UTSW	7	29067630	missense	probably damaging	1.00
R7790:Ryr1	UTSW	7	29104832	missense	probably benign	0.39
R7799:Ryr1	UTSW	7	29003560	splice site	probably null
R7916:Ryr1	UTSW	7	29090939	nonsense	probably null
R7922:Ryr1	UTSW	7	29097224	missense	probably benign	0.09
R7988:Ryr1	UTSW	7	29096171	missense	probably benign	0.29
R7997:Ryr1	UTSW	7	29003543	missense	unknown
R8052:Ryr1	UTSW	7	29083385	missense	probably benign	0.05
R8096:Ryr1	UTSW	7	29009201	missense	unknown
R8116:Ryr1	UTSW	7	29110883	missense	probably benign	0.03
R8202:Ryr1	UTSW	7	29091032	missense	probably benign	0.18
R8207:Ryr1	UTSW	7	29090225	missense	probably damaging	1.00
R8248:Ryr1	UTSW	7	29069121	missense	probably damaging	1.00
R8257:Ryr1	UTSW	7	29064639	missense	possibly damaging	0.82
R8354:Ryr1	UTSW	7	29015717	missense	unknown
R8454:Ryr1	UTSW	7	29015717	missense	unknown
R8487:Ryr1	UTSW	7	29040867	missense	probably damaging	0.97
R8529:Ryr1	UTSW	7	29070084	missense	possibly damaging	0.86
R8545:Ryr1	UTSW	7	29004814	unclassified	probably benign
R8678:Ryr1	UTSW	7	29077064	missense	probably damaging	0.99
R8717:Ryr1	UTSW	7	29052328	missense	probably benign	0.03
R8724:Ryr1	UTSW	7	29117377	missense	probably benign	0.04
R8755:Ryr1	UTSW	7	29092268	missense	probably benign	0.19
R8772:Ryr1	UTSW	7	29116132	missense	probably benign	0.05
R8790:Ryr1	UTSW	7	29076872	missense	probably damaging	1.00
R8793:Ryr1	UTSW	7	29064859	missense	probably damaging	1.00
R8836:Ryr1	UTSW	7	29074666	missense	probably damaging	1.00
R8858:Ryr1	UTSW	7	29109213	missense	probably benign	0.00
R8910:Ryr1	UTSW	7	29071915	missense	probably damaging	1.00
R8920:Ryr1	UTSW	7	29090215	missense	possibly damaging	0.89
R8938:Ryr1	UTSW	7	29101933	missense	probably damaging	1.00
R9035:Ryr1	UTSW	7	29090997	missense	probably damaging	0.97
R9115:Ryr1	UTSW	7	29104564	nonsense	probably null
R9123:Ryr1	UTSW	7	29071804	missense	probably damaging	1.00
R9154:Ryr1	UTSW	7	29069858	missense	probably benign	0.08
R9189:Ryr1	UTSW	7	29077046	missense	probably damaging	1.00
R9200:Ryr1	UTSW	7	29095099	missense	probably benign	0.00
R9214:Ryr1	UTSW	7	29085762	missense	possibly damaging	0.52
R9216:Ryr1	UTSW	7	29101852	missense	probably damaging	0.97
R9240:Ryr1	UTSW	7	29043888	missense	probably damaging	1.00
R9261:Ryr1	UTSW	7	29052388	missense	possibly damaging	0.91
R9276:Ryr1	UTSW	7	29102829	missense	probably damaging	0.99
R9280:Ryr1	UTSW	7	29102964	missense	probably damaging	1.00
R9316:Ryr1	UTSW	7	29017962	missense	unknown
R9333:Ryr1	UTSW	7	29074789	critical splice donor site	probably null
R9459:Ryr1	UTSW	7	29068643	missense	probably damaging	1.00
R9468:Ryr1	UTSW	7	29073085	missense	probably damaging	1.00
R9486:Ryr1	UTSW	7	29078540	missense	probably benign	0.15
R9524:Ryr1	UTSW	7	29024175	missense	probably damaging	1.00
R9620:Ryr1	UTSW	7	29015713	missense	unknown
R9664:Ryr1	UTSW	7	29059667	missense	probably damaging	1.00
R9776:Ryr1	UTSW	7	29075239	missense	probably damaging	1.00
X0021:Ryr1	UTSW	7	29061531	missense	probably damaging	1.00
Z1176:Ryr1	UTSW	7	29020214	missense	probably damaging	1.00
Z1176:Ryr1	UTSW	7	29086035	missense	probably benign	0.10
Z1176:Ryr1	UTSW	7	29103498	missense	probably damaging	1.00
Z1177:Ryr1	UTSW	7	29017985	missense	unknown
Z1177:Ryr1	UTSW	7	29048792	nonsense	probably null
Z1177:Ryr1	UTSW	7	29101922	missense	probably damaging	1.00
Z1186:Ryr1	UTSW	7	29082477	missense	possibly damaging	0.61

Predicted Primers

PCR Primer
(F):5'- GATTTTAATATGTCCAGCTTTGCACCCC -3'
(R):5'- AGTCCCTCCCGCTTATAGTAAGCC -3'

Sequencing Primer
(F):5'- CCTCCCCACTTCACATGC -3'
(R):5'- ccaacctctacccccactc -3'

Posted On

2014-04-13