Incidental Mutation 'R1572:Ticrr'
ID 170846
Institutional Source Beutler Lab
Gene Symbol Ticrr
Ensembl Gene ENSMUSG00000046591
Gene Name TOPBP1-interacting checkpoint and replication regulator
Synonyms 5730590G19Rik
MMRRC Submission 039611-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.949) question?
Stock # R1572 (G1)
Quality Score 184
Status Validated
Chromosome 7
Chromosomal Location 79309944-79347896 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 79331572 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 723 (V723A)
Ref Sequence ENSEMBL: ENSMUSP00000145735 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035977] [ENSMUST00000206017] [ENSMUST00000206591] [ENSMUST00000206622]
AlphaFold Q8BQ33
Predicted Effect possibly damaging
Transcript: ENSMUST00000035977
AA Change: V723A

PolyPhen 2 Score 0.922 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000041377
Gene: ENSMUSG00000046591
AA Change: V723A

DomainStartEndE-ValueType
low complexity region 23 31 N/A INTRINSIC
Pfam:Treslin_N 211 1005 N/A PFAM
low complexity region 1186 1197 N/A INTRINSIC
low complexity region 1220 1235 N/A INTRINSIC
low complexity region 1339 1359 N/A INTRINSIC
low complexity region 1472 1480 N/A INTRINSIC
low complexity region 1496 1514 N/A INTRINSIC
low complexity region 1630 1643 N/A INTRINSIC
low complexity region 1694 1707 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000206017
Predicted Effect probably damaging
Transcript: ENSMUST00000206591
AA Change: V723A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably benign
Transcript: ENSMUST00000206622
Meta Mutation Damage Score 0.1388 question?
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 97.5%
  • 10x: 92.9%
  • 20x: 80.7%
Validation Efficiency 97% (130/134)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Treslin is involved in the initiation of DNA replication (Kumagai et al., 2010 [PubMed 20116089]).[supplied by OMIM, Apr 2010]
PHENOTYPE: Mice homozygous for an ENU-induced allele are mostly hairless, with only a light patch of hair around the face and tail. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 112 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310030G06Rik G A 9: 50,651,973 (GRCm39) T85M probably damaging Het
Actn1 A G 12: 80,219,731 (GRCm39) probably benign Het
Afap1l1 A T 18: 61,870,570 (GRCm39) S603T probably damaging Het
Ahcy T C 2: 154,910,851 (GRCm39) Y39C probably benign Het
Ankmy2 T C 12: 36,236,941 (GRCm39) probably null Het
Anxa13 A T 15: 58,220,655 (GRCm39) noncoding transcript Het
Aoc1 T C 6: 48,882,720 (GRCm39) S221P possibly damaging Het
Arhgef10 C A 8: 15,041,211 (GRCm39) A770D possibly damaging Het
Arhgef19 A G 4: 140,982,065 (GRCm39) D707G probably benign Het
Arhgef3 G A 14: 27,123,692 (GRCm39) R444H probably damaging Het
Asphd1 T C 7: 126,548,271 (GRCm39) I11V probably benign Het
Atp2b1 A G 10: 98,830,537 (GRCm39) M333V probably benign Het
BC051665 T C 13: 60,932,841 (GRCm39) Y40C probably damaging Het
Ccdc87 T A 19: 4,890,341 (GRCm39) S278T probably benign Het
Ccn3 T A 15: 54,612,648 (GRCm39) M219K possibly damaging Het
Cdcp3 T A 7: 130,846,560 (GRCm39) Y777* probably null Het
Chaf1b G A 16: 93,698,118 (GRCm39) G463D possibly damaging Het
Chrna4 T C 2: 180,671,100 (GRCm39) T219A possibly damaging Het
Clcnkb T G 4: 141,134,406 (GRCm39) T584P possibly damaging Het
Clptm1l T C 13: 73,755,866 (GRCm39) S161P probably benign Het
Cmya5 T C 13: 93,230,777 (GRCm39) E1437G possibly damaging Het
Col13a1 A T 10: 61,702,205 (GRCm39) probably null Het
Col3a1 T C 1: 45,385,128 (GRCm39) S82P possibly damaging Het
Cpeb3 A T 19: 37,116,482 (GRCm39) M383K probably benign Het
Cr2 T A 1: 194,845,622 (GRCm39) H111L probably damaging Het
Cttnbp2 T C 6: 18,375,974 (GRCm39) S1522G possibly damaging Het
Cul3 T C 1: 80,260,506 (GRCm39) D281G possibly damaging Het
Cyp2c70 T G 19: 40,172,426 (GRCm39) K72T probably benign Het
Cyp39a1 A T 17: 43,991,020 (GRCm39) I110F probably damaging Het
Cyp46a1 T A 12: 108,318,198 (GRCm39) M203K probably null Het
Cyp8b1 A T 9: 121,744,024 (GRCm39) V436D possibly damaging Het
Ddx17 T C 15: 79,422,766 (GRCm39) D324G probably damaging Het
Dop1b A G 16: 93,567,041 (GRCm39) N1274S probably damaging Het
Dscaml1 G A 9: 45,632,631 (GRCm39) V1166I probably benign Het
Dsp T C 13: 38,379,714 (GRCm39) V1554A probably damaging Het
Efr3a T A 15: 65,726,641 (GRCm39) probably null Het
Egfem1 A T 3: 29,702,420 (GRCm39) N223I probably benign Het
Egr2 T C 10: 67,375,805 (GRCm39) S147P probably damaging Het
Elmo3 A G 8: 106,034,933 (GRCm39) T408A probably benign Het
Flnb A G 14: 7,883,908 (GRCm38) D378G probably damaging Het
Foxj2 T A 6: 122,810,220 (GRCm39) M193K probably benign Het
Gm6327 A G 16: 12,578,020 (GRCm39) noncoding transcript Het
Gm7694 T C 1: 170,130,335 (GRCm39) H21R probably benign Het
Gpr107 A G 2: 31,057,037 (GRCm39) D43G probably damaging Het
Grid2 T A 6: 64,406,678 (GRCm39) Y679* probably null Het
Grin2c G A 11: 115,146,900 (GRCm39) P432S possibly damaging Het
H2-M10.1 A G 17: 36,636,625 (GRCm39) F60L possibly damaging Het
Hectd4 A G 5: 121,439,941 (GRCm39) D1147G possibly damaging Het
Idua G T 5: 108,828,455 (GRCm39) A223S probably benign Het
Ifi206 T C 1: 173,314,419 (GRCm39) Q7R probably benign Het
Itgad T A 7: 127,802,406 (GRCm39) V986E probably damaging Het
Itsn2 G A 12: 4,700,044 (GRCm39) R670H probably benign Het
Kdm4a T C 4: 117,996,146 (GRCm39) E961G possibly damaging Het
Klra5 T A 6: 129,883,585 (GRCm39) I91L probably damaging Het
Kntc1 A G 5: 123,910,176 (GRCm39) T525A probably damaging Het
Lct A G 1: 128,221,932 (GRCm39) F1536L probably benign Het
Lmod1 T A 1: 135,291,671 (GRCm39) D175E probably benign Het
Lonrf1 A C 8: 36,701,126 (GRCm39) D361E probably benign Het
Lrrc19 T C 4: 94,526,666 (GRCm39) Y297C probably damaging Het
Mast4 T C 13: 102,873,431 (GRCm39) E1787G possibly damaging Het
Mpp2 G A 11: 101,951,374 (GRCm39) A452V probably benign Het
Msh2 T C 17: 88,026,080 (GRCm39) V686A possibly damaging Het
Mthfd1 C T 12: 76,317,193 (GRCm39) Q15* probably null Het
Mtnr1b A T 9: 15,774,438 (GRCm39) I207N probably damaging Het
Nid2 A G 14: 19,855,480 (GRCm39) T1207A probably benign Het
Nin A T 12: 70,085,524 (GRCm39) V1569D probably damaging Het
Nrcam T A 12: 44,584,147 (GRCm39) probably benign Het
Nsd1 T A 13: 55,394,782 (GRCm39) H897Q probably damaging Het
Or10g9 A G 9: 39,912,490 (GRCm39) F11S probably benign Het
Or12d2 A T 17: 37,624,371 (GRCm39) N301K probably benign Het
Or2w2 T A 13: 21,758,480 (GRCm39) I49F possibly damaging Het
Or7d10 G T 9: 19,832,208 (GRCm39) K234N probably benign Het
Paip1 T C 13: 119,588,320 (GRCm39) probably benign Het
Pcnx3 G A 19: 5,735,375 (GRCm39) R484* probably null Het
Pdxk A G 10: 78,283,814 (GRCm39) Y127H probably damaging Het
Phf20 T A 2: 156,129,754 (GRCm39) V442E probably benign Het
Phlpp1 G A 1: 106,320,519 (GRCm39) D1505N probably damaging Het
Pkhd1 T C 1: 20,417,664 (GRCm39) T2496A probably benign Het
Pkhd1l1 A G 15: 44,406,869 (GRCm39) T2369A probably benign Het
Plod2 T A 9: 92,485,120 (GRCm39) probably benign Het
Pnpla7 T A 2: 24,905,263 (GRCm39) M617K possibly damaging Het
Ppp1r16a C T 15: 76,577,869 (GRCm39) Q328* probably null Het
Prkch T A 12: 73,696,131 (GRCm39) probably null Het
Prr12 G A 7: 44,678,224 (GRCm39) H1974Y unknown Het
Prr16 A G 18: 51,436,042 (GRCm39) I174V probably benign Het
Prss45 A T 9: 110,667,497 (GRCm39) T39S probably benign Het
Pum1 T A 4: 130,445,515 (GRCm39) D161E probably damaging Het
Rad51ap2 A G 12: 11,507,113 (GRCm39) D345G probably damaging Het
Ralgapb A G 2: 158,288,119 (GRCm39) probably benign Het
Rasgrp3 A G 17: 75,807,729 (GRCm39) H262R possibly damaging Het
Rnf213 T A 11: 119,327,437 (GRCm39) I1809N probably damaging Het
Ryr1 A G 7: 28,761,616 (GRCm39) L3177P probably damaging Het
Scyl2 C A 10: 89,486,818 (GRCm39) R230L probably damaging Het
Sfxn2 T C 19: 46,570,915 (GRCm39) probably benign Het
Slc18b1 T C 10: 23,674,639 (GRCm39) probably benign Het
Spata31d1d T C 13: 59,876,005 (GRCm39) H510R probably benign Het
Stab1 A T 14: 30,872,780 (GRCm39) N1109K probably damaging Het
Styxl2 C T 1: 165,927,024 (GRCm39) V863M possibly damaging Het
Sult3a2 A G 10: 33,657,973 (GRCm39) S47P probably damaging Het
Tenm3 T C 8: 48,682,028 (GRCm39) N2518S possibly damaging Het
Tex21 G T 12: 76,253,665 (GRCm39) P416Q probably benign Het
Tex38 T C 4: 115,637,503 (GRCm39) N100S probably benign Het
Thsd4 A C 9: 60,301,836 (GRCm39) probably benign Het
Tmprss15 A G 16: 78,887,717 (GRCm39) V30A probably benign Het
Uba3 A G 6: 97,162,298 (GRCm39) probably benign Het
Ubr1 T C 2: 120,765,800 (GRCm39) probably benign Het
Uchl4 A T 9: 64,143,013 (GRCm39) I165L probably benign Het
Vmn2r112 A T 17: 22,822,125 (GRCm39) T268S possibly damaging Het
Wfdc3 T C 2: 164,586,114 (GRCm39) probably benign Het
Zfp282 T A 6: 47,869,801 (GRCm39) L282Q probably damaging Het
Zfp422 A T 6: 116,603,745 (GRCm39) C85S probably damaging Het
Zfp790 A T 7: 29,527,564 (GRCm39) Q83L probably benign Het
Other mutations in Ticrr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Ticrr APN 7 79,327,031 (GRCm39) missense probably damaging 1.00
IGL00596:Ticrr APN 7 79,327,041 (GRCm39) missense probably damaging 1.00
IGL01327:Ticrr APN 7 79,344,209 (GRCm39) missense probably benign 0.00
IGL01525:Ticrr APN 7 79,332,197 (GRCm39) missense probably damaging 1.00
IGL01565:Ticrr APN 7 79,344,296 (GRCm39) missense probably benign
IGL01936:Ticrr APN 7 79,344,297 (GRCm39) missense probably benign 0.11
IGL02160:Ticrr APN 7 79,343,767 (GRCm39) missense probably benign 0.29
IGL02246:Ticrr APN 7 79,325,076 (GRCm39) missense probably damaging 1.00
IGL02487:Ticrr APN 7 79,332,769 (GRCm39) missense possibly damaging 0.86
IGL02593:Ticrr APN 7 79,345,214 (GRCm39) missense probably damaging 0.99
IGL02970:Ticrr APN 7 79,344,919 (GRCm39) missense probably benign 0.01
FR4304:Ticrr UTSW 7 79,344,059 (GRCm39) intron probably benign
PIT4305001:Ticrr UTSW 7 79,328,771 (GRCm39) missense possibly damaging 0.95
PIT4791001:Ticrr UTSW 7 79,319,386 (GRCm39) missense possibly damaging 0.92
R0016:Ticrr UTSW 7 79,343,540 (GRCm39) missense probably benign 0.01
R0062:Ticrr UTSW 7 79,317,654 (GRCm39) missense probably benign 0.01
R0062:Ticrr UTSW 7 79,317,654 (GRCm39) missense probably benign 0.01
R0067:Ticrr UTSW 7 79,327,158 (GRCm39) missense probably damaging 1.00
R0067:Ticrr UTSW 7 79,327,158 (GRCm39) missense probably damaging 1.00
R0362:Ticrr UTSW 7 79,327,088 (GRCm39) missense probably damaging 1.00
R0482:Ticrr UTSW 7 79,344,236 (GRCm39) missense probably damaging 0.99
R0595:Ticrr UTSW 7 79,345,311 (GRCm39) missense possibly damaging 0.94
R1118:Ticrr UTSW 7 79,343,701 (GRCm39) missense probably benign 0.23
R1119:Ticrr UTSW 7 79,343,701 (GRCm39) missense probably benign 0.23
R1658:Ticrr UTSW 7 79,345,297 (GRCm39) missense possibly damaging 0.57
R1757:Ticrr UTSW 7 79,328,794 (GRCm39) nonsense probably null
R1757:Ticrr UTSW 7 79,325,071 (GRCm39) missense probably damaging 0.99
R1862:Ticrr UTSW 7 79,344,955 (GRCm39) missense probably damaging 1.00
R1869:Ticrr UTSW 7 79,328,883 (GRCm39) missense probably damaging 1.00
R1938:Ticrr UTSW 7 79,325,142 (GRCm39) missense probably damaging 0.98
R1966:Ticrr UTSW 7 79,344,483 (GRCm39) nonsense probably null
R2006:Ticrr UTSW 7 79,343,821 (GRCm39) missense possibly damaging 0.93
R2178:Ticrr UTSW 7 79,315,433 (GRCm39) missense probably benign 0.12
R3404:Ticrr UTSW 7 79,344,539 (GRCm39) missense probably benign 0.06
R3405:Ticrr UTSW 7 79,344,539 (GRCm39) missense probably benign 0.06
R3941:Ticrr UTSW 7 79,343,445 (GRCm39) intron probably benign
R3950:Ticrr UTSW 7 79,331,817 (GRCm39) missense probably damaging 1.00
R3951:Ticrr UTSW 7 79,331,817 (GRCm39) missense probably damaging 1.00
R3952:Ticrr UTSW 7 79,331,817 (GRCm39) missense probably damaging 1.00
R4967:Ticrr UTSW 7 79,310,158 (GRCm39) missense probably damaging 0.99
R4972:Ticrr UTSW 7 79,319,416 (GRCm39) missense probably damaging 0.98
R5259:Ticrr UTSW 7 79,344,471 (GRCm39) missense probably benign 0.01
R5272:Ticrr UTSW 7 79,319,353 (GRCm39) missense probably benign 0.44
R5374:Ticrr UTSW 7 79,340,690 (GRCm39) nonsense probably null
R5480:Ticrr UTSW 7 79,310,557 (GRCm39) missense probably damaging 1.00
R5568:Ticrr UTSW 7 79,345,044 (GRCm39) nonsense probably null
R5568:Ticrr UTSW 7 79,339,715 (GRCm39) critical splice donor site probably null
R5588:Ticrr UTSW 7 79,328,853 (GRCm39) missense probably damaging 1.00
R5698:Ticrr UTSW 7 79,328,881 (GRCm39) missense probably benign
R5879:Ticrr UTSW 7 79,346,438 (GRCm39) missense probably benign 0.12
R5980:Ticrr UTSW 7 79,310,703 (GRCm39) missense probably damaging 0.99
R6128:Ticrr UTSW 7 79,343,716 (GRCm39) missense probably damaging 1.00
R6277:Ticrr UTSW 7 79,344,444 (GRCm39) missense probably benign 0.00
R6335:Ticrr UTSW 7 79,344,031 (GRCm39) splice site probably null
R6866:Ticrr UTSW 7 79,343,705 (GRCm39) missense possibly damaging 0.47
R6905:Ticrr UTSW 7 79,315,598 (GRCm39) missense probably benign 0.00
R6923:Ticrr UTSW 7 79,341,601 (GRCm39) missense probably damaging 0.98
R6962:Ticrr UTSW 7 79,315,645 (GRCm39) missense possibly damaging 0.84
R7232:Ticrr UTSW 7 79,343,490 (GRCm39) missense probably damaging 0.96
R7285:Ticrr UTSW 7 79,310,610 (GRCm39) missense possibly damaging 0.93
R7385:Ticrr UTSW 7 79,341,597 (GRCm39) missense possibly damaging 0.93
R7426:Ticrr UTSW 7 79,343,734 (GRCm39) missense probably benign
R7583:Ticrr UTSW 7 79,346,487 (GRCm39) nonsense probably null
R7749:Ticrr UTSW 7 79,328,844 (GRCm39) missense possibly damaging 0.94
R7863:Ticrr UTSW 7 79,331,760 (GRCm39) missense possibly damaging 0.92
R7899:Ticrr UTSW 7 79,319,233 (GRCm39) missense probably benign 0.23
R7935:Ticrr UTSW 7 79,331,584 (GRCm39) missense probably damaging 0.99
R8005:Ticrr UTSW 7 79,343,796 (GRCm39) missense probably damaging 0.98
R8080:Ticrr UTSW 7 79,334,012 (GRCm39) splice site probably null
R8181:Ticrr UTSW 7 79,310,728 (GRCm39) missense possibly damaging 0.92
R8349:Ticrr UTSW 7 79,344,428 (GRCm39) missense probably benign 0.27
R8410:Ticrr UTSW 7 79,317,423 (GRCm39) missense probably damaging 0.98
R8449:Ticrr UTSW 7 79,344,428 (GRCm39) missense probably benign 0.27
R9073:Ticrr UTSW 7 79,317,679 (GRCm39) missense probably benign 0.01
R9090:Ticrr UTSW 7 79,310,604 (GRCm39) missense possibly damaging 0.85
R9271:Ticrr UTSW 7 79,310,604 (GRCm39) missense possibly damaging 0.85
R9287:Ticrr UTSW 7 79,343,516 (GRCm39) missense possibly damaging 0.89
R9368:Ticrr UTSW 7 79,330,735 (GRCm39) missense probably damaging 0.99
R9469:Ticrr UTSW 7 79,344,511 (GRCm39) missense probably benign 0.03
R9502:Ticrr UTSW 7 79,343,597 (GRCm39) missense probably benign
R9614:Ticrr UTSW 7 79,345,754 (GRCm39) missense probably damaging 1.00
R9761:Ticrr UTSW 7 79,345,313 (GRCm39) missense probably damaging 1.00
R9779:Ticrr UTSW 7 79,328,802 (GRCm39) missense probably benign 0.37
Predicted Primers PCR Primer
(F):5'- ACCTGTGCCCTGCTTGCTTG -3'
(R):5'- CGCAGCAAATCTGTCACCTGAAAG -3'

Sequencing Primer
(F):5'- ttgcttgctttctttctttctttc -3'
(R):5'- CTGTCACCTGAAAGAGATTGC -3'
Posted On 2014-04-13