Incidental Mutation 'R1572:Nin'
ID 170880
Institutional Source Beutler Lab
Gene Symbol Nin
Ensembl Gene ENSMUSG00000021068
Gene Name ninein
Synonyms 3110068G20Rik
MMRRC Submission 039611-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1572 (G1)
Quality Score 225
Status Validated
Chromosome 12
Chromosomal Location 70011435-70113717 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 70038750 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Aspartic acid at position 1569 (V1569D)
Ref Sequence ENSEMBL: ENSMUSP00000152350 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021468] [ENSMUST00000085314] [ENSMUST00000095666] [ENSMUST00000169074] [ENSMUST00000220689] [ENSMUST00000222237] [ENSMUST00000222835] [ENSMUST00000223257]
AlphaFold Q61043
Predicted Effect probably damaging
Transcript: ENSMUST00000021468
AA Change: V1569D

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000021468
Gene: ENSMUSG00000021068
AA Change: V1569D

DomainStartEndE-ValueType
internal_repeat_1 7 67 7.83e-8 PROSPERO
low complexity region 97 108 N/A INTRINSIC
low complexity region 115 132 N/A INTRINSIC
internal_repeat_1 181 242 7.83e-8 PROSPERO
low complexity region 276 289 N/A INTRINSIC
low complexity region 336 353 N/A INTRINSIC
coiled coil region 358 570 N/A INTRINSIC
coiled coil region 625 802 N/A INTRINSIC
coiled coil region 834 926 N/A INTRINSIC
coiled coil region 957 1008 N/A INTRINSIC
low complexity region 1035 1044 N/A INTRINSIC
low complexity region 1047 1057 N/A INTRINSIC
coiled coil region 1069 1094 N/A INTRINSIC
coiled coil region 1178 1325 N/A INTRINSIC
low complexity region 1374 1385 N/A INTRINSIC
coiled coil region 1425 1806 N/A INTRINSIC
coiled coil region 1980 2013 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000085314
AA Change: V1569D

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000082422
Gene: ENSMUSG00000021068
AA Change: V1569D

DomainStartEndE-ValueType
internal_repeat_1 7 67 4.15e-8 PROSPERO
low complexity region 97 108 N/A INTRINSIC
low complexity region 115 132 N/A INTRINSIC
internal_repeat_1 181 242 4.15e-8 PROSPERO
low complexity region 276 289 N/A INTRINSIC
low complexity region 336 353 N/A INTRINSIC
coiled coil region 358 570 N/A INTRINSIC
coiled coil region 625 802 N/A INTRINSIC
coiled coil region 834 926 N/A INTRINSIC
coiled coil region 957 1008 N/A INTRINSIC
low complexity region 1035 1044 N/A INTRINSIC
low complexity region 1047 1057 N/A INTRINSIC
coiled coil region 1069 1094 N/A INTRINSIC
coiled coil region 1178 1325 N/A INTRINSIC
low complexity region 1374 1385 N/A INTRINSIC
coiled coil region 1425 1806 N/A INTRINSIC
coiled coil region 1971 2045 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000095666
AA Change: V1569D

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000093327
Gene: ENSMUSG00000021068
AA Change: V1569D

DomainStartEndE-ValueType
internal_repeat_1 7 67 7.83e-8 PROSPERO
low complexity region 97 108 N/A INTRINSIC
low complexity region 115 132 N/A INTRINSIC
internal_repeat_1 181 242 7.83e-8 PROSPERO
low complexity region 276 289 N/A INTRINSIC
low complexity region 336 353 N/A INTRINSIC
coiled coil region 358 570 N/A INTRINSIC
coiled coil region 625 802 N/A INTRINSIC
coiled coil region 834 926 N/A INTRINSIC
coiled coil region 957 1008 N/A INTRINSIC
low complexity region 1035 1044 N/A INTRINSIC
low complexity region 1047 1057 N/A INTRINSIC
coiled coil region 1069 1094 N/A INTRINSIC
coiled coil region 1178 1325 N/A INTRINSIC
low complexity region 1374 1385 N/A INTRINSIC
coiled coil region 1425 1806 N/A INTRINSIC
coiled coil region 1980 2013 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000169074
AA Change: V1569D

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000129648
Gene: ENSMUSG00000021068
AA Change: V1569D

DomainStartEndE-ValueType
internal_repeat_1 7 67 7.83e-8 PROSPERO
low complexity region 97 108 N/A INTRINSIC
low complexity region 115 132 N/A INTRINSIC
internal_repeat_1 181 242 7.83e-8 PROSPERO
low complexity region 276 289 N/A INTRINSIC
low complexity region 336 353 N/A INTRINSIC
coiled coil region 358 570 N/A INTRINSIC
coiled coil region 625 802 N/A INTRINSIC
coiled coil region 834 926 N/A INTRINSIC
coiled coil region 957 1008 N/A INTRINSIC
low complexity region 1035 1044 N/A INTRINSIC
low complexity region 1047 1057 N/A INTRINSIC
coiled coil region 1069 1094 N/A INTRINSIC
coiled coil region 1178 1325 N/A INTRINSIC
low complexity region 1374 1385 N/A INTRINSIC
coiled coil region 1425 1806 N/A INTRINSIC
coiled coil region 1980 2013 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000220689
AA Change: V862D

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221486
Predicted Effect probably damaging
Transcript: ENSMUST00000222237
AA Change: V1569D

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
Predicted Effect possibly damaging
Transcript: ENSMUST00000222835
AA Change: V862D

PolyPhen 2 Score 0.787 (Sensitivity: 0.85; Specificity: 0.93)
Predicted Effect probably damaging
Transcript: ENSMUST00000223257
AA Change: V1569D

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223469
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 97.5%
  • 10x: 92.9%
  • 20x: 80.7%
Validation Efficiency 97% (130/134)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the proteins important for centrosomal function. This protein is important for positioning and anchoring the microtubules minus-ends in epithelial cells. Localization of this protein to the centrosome requires three leucine zippers in the central coiled-coil domain. Multiple alternatively spliced transcript variants that encode different isoforms have been reported. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 112 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310030G06Rik G A 9: 50,740,673 (GRCm38) T85M probably damaging Het
5430419D17Rik T A 7: 131,244,831 (GRCm38) Y777* probably null Het
Actn1 A G 12: 80,172,957 (GRCm38) probably benign Het
Afap1l1 A T 18: 61,737,499 (GRCm38) S603T probably damaging Het
Ahcy T C 2: 155,068,931 (GRCm38) Y39C probably benign Het
Ankmy2 T C 12: 36,186,942 (GRCm38) probably null Het
Anxa13 A T 15: 58,348,807 (GRCm38) noncoding transcript Het
Aoc1 T C 6: 48,905,786 (GRCm38) S221P possibly damaging Het
Arhgef10 C A 8: 14,991,211 (GRCm38) A770D possibly damaging Het
Arhgef19 A G 4: 141,254,754 (GRCm38) D707G probably benign Het
Arhgef3 G A 14: 27,401,735 (GRCm38) R444H probably damaging Het
Asphd1 T C 7: 126,949,099 (GRCm38) I11V probably benign Het
Atp2b1 A G 10: 98,994,675 (GRCm38) M333V probably benign Het
BC051665 T C 13: 60,785,027 (GRCm38) Y40C probably damaging Het
Ccdc87 T A 19: 4,840,313 (GRCm38) S278T probably benign Het
Chaf1b G A 16: 93,901,230 (GRCm38) G463D possibly damaging Het
Chrna4 T C 2: 181,029,307 (GRCm38) T219A possibly damaging Het
Clcnkb T G 4: 141,407,095 (GRCm38) T584P possibly damaging Het
Clptm1l T C 13: 73,607,747 (GRCm38) S161P probably benign Het
Cmya5 T C 13: 93,094,269 (GRCm38) E1437G possibly damaging Het
Col13a1 A T 10: 61,866,426 (GRCm38) probably null Het
Col3a1 T C 1: 45,345,968 (GRCm38) S82P possibly damaging Het
Cpeb3 A T 19: 37,139,082 (GRCm38) M383K probably benign Het
Cr2 T A 1: 195,163,314 (GRCm38) H111L probably damaging Het
Cttnbp2 T C 6: 18,375,975 (GRCm38) S1522G possibly damaging Het
Cul3 T C 1: 80,282,789 (GRCm38) D281G possibly damaging Het
Cyp2c70 T G 19: 40,183,982 (GRCm38) K72T probably benign Het
Cyp39a1 A T 17: 43,680,129 (GRCm38) I110F probably damaging Het
Cyp46a1 T A 12: 108,351,939 (GRCm38) M203K probably null Het
Cyp8b1 A T 9: 121,914,958 (GRCm38) V436D possibly damaging Het
Ddx17 T C 15: 79,538,565 (GRCm38) D324G probably damaging Het
Dopey2 A G 16: 93,770,153 (GRCm38) N1274S probably damaging Het
Dscaml1 G A 9: 45,721,333 (GRCm38) V1166I probably benign Het
Dsp T C 13: 38,195,738 (GRCm38) V1554A probably damaging Het
Dusp27 C T 1: 166,099,455 (GRCm38) V863M possibly damaging Het
Efr3a T A 15: 65,854,792 (GRCm38) probably null Het
Egfem1 A T 3: 29,648,271 (GRCm38) N223I probably benign Het
Egr2 T C 10: 67,539,975 (GRCm38) S147P probably damaging Het
Elmo3 A G 8: 105,308,301 (GRCm38) T408A probably benign Het
Flnb A G 14: 7,883,908 (GRCm38) D378G probably damaging Het
Foxj2 T A 6: 122,833,261 (GRCm38) M193K probably benign Het
Gm6327 A G 16: 12,760,156 (GRCm38) noncoding transcript Het
Gm7694 T C 1: 170,302,766 (GRCm38) H21R probably benign Het
Gpr107 A G 2: 31,167,025 (GRCm38) D43G probably damaging Het
Grid2 T A 6: 64,429,694 (GRCm38) Y679* probably null Het
Grin2c G A 11: 115,256,074 (GRCm38) P432S possibly damaging Het
H2-M10.1 A G 17: 36,325,733 (GRCm38) F60L possibly damaging Het
Hectd4 A G 5: 121,301,878 (GRCm38) D1147G possibly damaging Het
Idua G T 5: 108,680,589 (GRCm38) A223S probably benign Het
Ifi206 T C 1: 173,486,853 (GRCm38) Q7R probably benign Het
Itgad T A 7: 128,203,234 (GRCm38) V986E probably damaging Het
Itsn2 G A 12: 4,650,044 (GRCm38) R670H probably benign Het
Kdm4a T C 4: 118,138,949 (GRCm38) E961G possibly damaging Het
Klra5 T A 6: 129,906,622 (GRCm38) I91L probably damaging Het
Kntc1 A G 5: 123,772,113 (GRCm38) T525A probably damaging Het
Lct A G 1: 128,294,195 (GRCm38) F1536L probably benign Het
Lmod1 T A 1: 135,363,933 (GRCm38) D175E probably benign Het
Lonrf1 A C 8: 36,233,972 (GRCm38) D361E probably benign Het
Lrrc19 T C 4: 94,638,429 (GRCm38) Y297C probably damaging Het
Mast4 T C 13: 102,736,923 (GRCm38) E1787G possibly damaging Het
Mpp2 G A 11: 102,060,548 (GRCm38) A452V probably benign Het
Msh2 T C 17: 87,718,652 (GRCm38) V686A possibly damaging Het
Mthfd1 C T 12: 76,270,419 (GRCm38) Q15* probably null Het
Mtnr1b A T 9: 15,863,142 (GRCm38) I207N probably damaging Het
Nid2 A G 14: 19,805,412 (GRCm38) T1207A probably benign Het
Nov T A 15: 54,749,252 (GRCm38) M219K possibly damaging Het
Nrcam T A 12: 44,537,364 (GRCm38) probably benign Het
Nsd1 T A 13: 55,246,969 (GRCm38) H897Q probably damaging Het
Olfr102 A T 17: 37,313,480 (GRCm38) N301K probably benign Het
Olfr1364 T A 13: 21,574,310 (GRCm38) I49F possibly damaging Het
Olfr77 G T 9: 19,920,912 (GRCm38) K234N probably benign Het
Olfr979 A G 9: 40,001,194 (GRCm38) F11S probably benign Het
Paip1 T C 13: 119,451,784 (GRCm38) probably benign Het
Pcnx3 G A 19: 5,685,347 (GRCm38) R484* probably null Het
Pdxk A G 10: 78,447,980 (GRCm38) Y127H probably damaging Het
Phf20 T A 2: 156,287,834 (GRCm38) V442E probably benign Het
Phlpp1 G A 1: 106,392,789 (GRCm38) D1505N probably damaging Het
Pkhd1 T C 1: 20,347,440 (GRCm38) T2496A probably benign Het
Pkhd1l1 A G 15: 44,543,473 (GRCm38) T2369A probably benign Het
Plod2 T A 9: 92,603,067 (GRCm38) probably benign Het
Pnpla7 T A 2: 25,015,251 (GRCm38) M617K possibly damaging Het
Ppp1r16a C T 15: 76,693,669 (GRCm38) Q328* probably null Het
Prkch T A 12: 73,649,357 (GRCm38) probably null Het
Prr12 G A 7: 45,028,800 (GRCm38) H1974Y unknown Het
Prr16 A G 18: 51,302,970 (GRCm38) I174V probably benign Het
Prss45 A T 9: 110,838,429 (GRCm38) T39S probably benign Het
Pum1 T A 4: 130,718,204 (GRCm38) D161E probably damaging Het
Rad51ap2 A G 12: 11,457,112 (GRCm38) D345G probably damaging Het
Ralgapb A G 2: 158,446,199 (GRCm38) probably benign Het
Rasgrp3 A G 17: 75,500,734 (GRCm38) H262R possibly damaging Het
Rnf213 T A 11: 119,436,611 (GRCm38) I1809N probably damaging Het
Ryr1 A G 7: 29,062,191 (GRCm38) L3177P probably damaging Het
Scyl2 C A 10: 89,650,956 (GRCm38) R230L probably damaging Het
Sfxn2 T C 19: 46,582,476 (GRCm38) probably benign Het
Slc18b1 T C 10: 23,798,741 (GRCm38) probably benign Het
Spata31d1d T C 13: 59,728,191 (GRCm38) H510R probably benign Het
Stab1 A T 14: 31,150,823 (GRCm38) N1109K probably damaging Het
Sult3a2 A G 10: 33,781,977 (GRCm38) S47P probably damaging Het
Tenm3 T C 8: 48,228,993 (GRCm38) N2518S possibly damaging Het
Tex21 G T 12: 76,206,891 (GRCm38) P416Q probably benign Het
Tex38 T C 4: 115,780,306 (GRCm38) N100S probably benign Het
Thsd4 A C 9: 60,394,553 (GRCm38) probably benign Het
Ticrr T C 7: 79,681,824 (GRCm38) V723A probably damaging Het
Tmprss15 A G 16: 79,090,829 (GRCm38) V30A probably benign Het
Uba3 A G 6: 97,185,337 (GRCm38) probably benign Het
Ubr1 T C 2: 120,935,319 (GRCm38) probably benign Het
Uchl4 A T 9: 64,235,731 (GRCm38) I165L probably benign Het
Vmn2r112 A T 17: 22,603,144 (GRCm38) T268S possibly damaging Het
Wfdc3 T C 2: 164,744,194 (GRCm38) probably benign Het
Zfp282 T A 6: 47,892,867 (GRCm38) L282Q probably damaging Het
Zfp422 A T 6: 116,626,784 (GRCm38) C85S probably damaging Het
Zfp790 A T 7: 29,828,139 (GRCm38) Q83L probably benign Het
Other mutations in Nin
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00472:Nin APN 12 70,030,088 (GRCm38) missense probably damaging 0.98
IGL00677:Nin APN 12 70,026,860 (GRCm38) missense probably damaging 1.00
IGL00823:Nin APN 12 70,014,793 (GRCm38) missense probably benign 0.01
IGL01103:Nin APN 12 70,056,758 (GRCm38) missense probably damaging 0.99
IGL01113:Nin APN 12 70,031,779 (GRCm38) missense probably damaging 1.00
IGL01420:Nin APN 12 70,045,414 (GRCm38) missense probably benign 0.08
IGL01556:Nin APN 12 70,043,188 (GRCm38) missense probably benign 0.01
IGL01663:Nin APN 12 70,043,665 (GRCm38) missense possibly damaging 0.72
IGL02002:Nin APN 12 70,062,699 (GRCm38) nonsense probably null
IGL02030:Nin APN 12 70,045,268 (GRCm38) missense probably damaging 1.00
IGL02202:Nin APN 12 70,055,436 (GRCm38) missense probably damaging 1.00
IGL02207:Nin APN 12 70,056,657 (GRCm38) missense probably damaging 0.99
IGL02257:Nin APN 12 70,102,691 (GRCm38) missense possibly damaging 0.71
IGL02394:Nin APN 12 70,044,031 (GRCm38) missense probably damaging 1.00
IGL02531:Nin APN 12 70,020,932 (GRCm38) missense probably benign 0.02
IGL03028:Nin APN 12 70,035,270 (GRCm38) missense probably benign 0.13
IGL03155:Nin APN 12 70,031,770 (GRCm38) missense probably damaging 1.00
IGL03197:Nin APN 12 70,026,810 (GRCm38) missense probably benign 0.03
IGL02835:Nin UTSW 12 70,056,738 (GRCm38) missense probably damaging 1.00
R0131:Nin UTSW 12 70,051,141 (GRCm38) missense probably damaging 1.00
R0131:Nin UTSW 12 70,051,141 (GRCm38) missense probably damaging 1.00
R0132:Nin UTSW 12 70,051,141 (GRCm38) missense probably damaging 1.00
R0211:Nin UTSW 12 70,014,875 (GRCm38) missense probably damaging 1.00
R0211:Nin UTSW 12 70,014,875 (GRCm38) missense probably damaging 1.00
R0734:Nin UTSW 12 70,030,113 (GRCm38) missense probably benign 0.01
R0947:Nin UTSW 12 70,061,186 (GRCm38) missense probably damaging 1.00
R1085:Nin UTSW 12 70,020,962 (GRCm38) missense possibly damaging 0.91
R1367:Nin UTSW 12 70,043,929 (GRCm38) missense probably damaging 0.99
R1452:Nin UTSW 12 70,017,650 (GRCm38) nonsense probably null
R1477:Nin UTSW 12 70,044,184 (GRCm38) missense possibly damaging 0.87
R1518:Nin UTSW 12 70,014,773 (GRCm38) missense probably benign 0.27
R1566:Nin UTSW 12 70,054,479 (GRCm38) missense probably damaging 0.99
R1583:Nin UTSW 12 70,031,738 (GRCm38) missense probably benign
R1584:Nin UTSW 12 70,042,669 (GRCm38) missense probably benign 0.03
R1699:Nin UTSW 12 70,045,563 (GRCm38) missense possibly damaging 0.87
R1699:Nin UTSW 12 70,030,938 (GRCm38) missense probably benign 0.40
R1765:Nin UTSW 12 70,042,891 (GRCm38) missense probably damaging 1.00
R1794:Nin UTSW 12 70,043,795 (GRCm38) nonsense probably null
R1952:Nin UTSW 12 70,030,926 (GRCm38) missense probably damaging 1.00
R2004:Nin UTSW 12 70,025,477 (GRCm38) missense probably benign 0.01
R2025:Nin UTSW 12 70,030,008 (GRCm38) missense probably damaging 1.00
R2060:Nin UTSW 12 70,042,418 (GRCm38) missense possibly damaging 0.64
R2213:Nin UTSW 12 70,045,354 (GRCm38) missense probably damaging 1.00
R2224:Nin UTSW 12 70,061,230 (GRCm38) missense probably damaging 1.00
R2247:Nin UTSW 12 70,054,545 (GRCm38) missense probably damaging 1.00
R2972:Nin UTSW 12 70,062,713 (GRCm38) missense probably damaging 1.00
R3776:Nin UTSW 12 70,038,682 (GRCm38) missense possibly damaging 0.71
R3881:Nin UTSW 12 70,042,541 (GRCm38) missense probably benign 0.00
R3930:Nin UTSW 12 70,078,242 (GRCm38) missense probably damaging 1.00
R3959:Nin UTSW 12 70,050,752 (GRCm38) missense probably damaging 1.00
R4229:Nin UTSW 12 70,051,210 (GRCm38) missense probably damaging 0.99
R4359:Nin UTSW 12 70,014,938 (GRCm38) missense probably benign 0.00
R4423:Nin UTSW 12 70,042,978 (GRCm38) missense probably damaging 1.00
R4461:Nin UTSW 12 70,042,585 (GRCm38) missense probably benign 0.37
R4639:Nin UTSW 12 70,038,601 (GRCm38) missense probably damaging 0.97
R4791:Nin UTSW 12 70,043,807 (GRCm38) missense possibly damaging 0.94
R4839:Nin UTSW 12 70,090,551 (GRCm38) missense possibly damaging 0.46
R4912:Nin UTSW 12 70,044,063 (GRCm38) missense probably damaging 1.00
R5712:Nin UTSW 12 70,042,769 (GRCm38) missense probably damaging 1.00
R5726:Nin UTSW 12 70,078,179 (GRCm38) missense probably damaging 1.00
R5804:Nin UTSW 12 70,045,601 (GRCm38) missense possibly damaging 0.58
R5874:Nin UTSW 12 70,030,918 (GRCm38) missense possibly damaging 0.94
R5992:Nin UTSW 12 70,045,524 (GRCm38) missense possibly damaging 0.83
R6077:Nin UTSW 12 70,019,232 (GRCm38) missense probably damaging 1.00
R6184:Nin UTSW 12 70,043,737 (GRCm38) missense probably damaging 1.00
R6307:Nin UTSW 12 70,014,857 (GRCm38) missense possibly damaging 0.91
R6315:Nin UTSW 12 70,045,615 (GRCm38) missense probably damaging 1.00
R6326:Nin UTSW 12 70,045,181 (GRCm38) missense possibly damaging 0.95
R6492:Nin UTSW 12 70,054,534 (GRCm38) missense probably benign 0.22
R6562:Nin UTSW 12 70,055,954 (GRCm38) missense probably damaging 1.00
R6578:Nin UTSW 12 70,061,194 (GRCm38) missense probably damaging 0.99
R6613:Nin UTSW 12 70,030,954 (GRCm38) missense probably damaging 1.00
R7112:Nin UTSW 12 70,102,799 (GRCm38) missense
R7170:Nin UTSW 12 70,044,239 (GRCm38) missense
R7324:Nin UTSW 12 70,043,734 (GRCm38) missense
R7338:Nin UTSW 12 70,044,064 (GRCm38) missense
R7372:Nin UTSW 12 70,056,029 (GRCm38) missense
R7431:Nin UTSW 12 70,078,223 (GRCm38) missense
R7577:Nin UTSW 12 70,062,706 (GRCm38) missense
R7655:Nin UTSW 12 70,042,768 (GRCm38) missense
R7656:Nin UTSW 12 70,042,768 (GRCm38) missense
R7683:Nin UTSW 12 70,078,182 (GRCm38) missense
R7769:Nin UTSW 12 70,043,230 (GRCm38) missense
R7981:Nin UTSW 12 70,042,817 (GRCm38) missense
R8138:Nin UTSW 12 70,042,898 (GRCm38) missense
R8141:Nin UTSW 12 70,030,021 (GRCm38) missense
R8754:Nin UTSW 12 70,031,013 (GRCm38) intron probably benign
R8790:Nin UTSW 12 70,021,019 (GRCm38) missense
R8899:Nin UTSW 12 70,030,936 (GRCm38) missense probably damaging 1.00
R8974:Nin UTSW 12 70,078,158 (GRCm38) missense
R9085:Nin UTSW 12 70,030,012 (GRCm38) nonsense probably null
R9143:Nin UTSW 12 70,090,575 (GRCm38) missense
R9380:Nin UTSW 12 70,028,031 (GRCm38) missense
R9496:Nin UTSW 12 70,055,988 (GRCm38) missense
R9638:Nin UTSW 12 70,020,844 (GRCm38) missense
R9709:Nin UTSW 12 70,102,694 (GRCm38) missense
R9745:Nin UTSW 12 70,043,125 (GRCm38) missense
R9792:Nin UTSW 12 70,047,235 (GRCm38) missense
Z1176:Nin UTSW 12 70,049,164 (GRCm38) critical splice acceptor site probably null
Z1177:Nin UTSW 12 70,054,426 (GRCm38) missense
Z1177:Nin UTSW 12 70,044,095 (GRCm38) missense
Predicted Primers PCR Primer
(F):5'- CCTGACCTGCACTTTGTAGTGATCC -3'
(R):5'- ACCCCGTGGTCTGAGATTAACCTG -3'

Sequencing Primer
(F):5'- GCACTTTGTAGTGATCCAGTTC -3'
(R):5'- CTAGACGCAAGGCTGCC -3'
Posted On 2014-04-13