Mutagenetix > Incidental Mutation

Incidental Mutation 'R1572:Dsp'

170888

Institutional Source

Beutler Lab

Gene Symbol

Dsp

Ensembl Gene

ENSMUSG00000054889

Gene Name

desmoplakin

Synonyms

5730453H04Rik, DP, 2300002E22Rik

MMRRC Submission

039611-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R1572 (G1)

Quality Score

197

Status

Validated

Chromosome

Chromosomal Location

38151294-38198577 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 38195738 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 1554 (V1554A)

Ref Sequence

ENSEMBL: ENSMUSP00000117252 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000124830] [ENSMUST00000127906]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000124830
AA Change: V2153A

PolyPhen 2 Score 0.775 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000115062
Gene: ENSMUSG00000054889
AA Change: V2153A

Domain	Start	End	E-Value	Type
Blast:SPEC	193	282	2e-51	BLAST
SPEC	285	385	6.03e-2	SMART
Blast:SPEC	391	557	1e-96	BLAST
Blast:SPEC	783	894	4e-34	BLAST
SPEC	901	1030	1.39e0	SMART
coiled coil region	1033	1370	N/A	INTRINSIC
coiled coil region	1394	1956	N/A	INTRINSIC
low complexity region	1997	2011	N/A	INTRINSIC
PLEC	2021	2057	3.33e-1	SMART
PLEC	2058	2095	3.76e-9	SMART
PLEC	2096	2133	4.09e-10	SMART
PLEC	2134	2171	2.09e-7	SMART
PLEC	2175	2209	4.83e1	SMART
PLEC	2210	2245	5.67e1	SMART
PLEC	2263	2300	1.22e-8	SMART
PLEC	2301	2338	1.16e-9	SMART
PLEC	2339	2376	1.12e-7	SMART
PLEC	2377	2414	1.56e-6	SMART
PLEC	2418	2452	1.42e0	SMART
PLEC	2468	2505	3.7e-8	SMART
low complexity region	2507	2517	N/A	INTRINSIC
PLEC	2519	2556	3.73e-4	SMART
low complexity region	2577	2593	N/A	INTRINSIC
PLEC	2622	2659	1.46e-6	SMART
PLEC	2660	2697	6.69e-15	SMART
PLEC	2698	2735	1.98e2	SMART
PLEC	2736	2773	2.35e-10	SMART
PLEC	2774	2811	1.39e-3	SMART
low complexity region	2835	2860	N/A	INTRINSIC
low complexity region	2867	2879	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000127906
AA Change: V1554A

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000117252
Gene: ENSMUSG00000054889
AA Change: V1554A

Domain	Start	End	E-Value	Type
Blast:SPEC	193	282	2e-51	BLAST
SPEC	285	385	6.03e-2	SMART
Blast:SPEC	391	557	1e-95	BLAST
Blast:SPEC	783	894	3e-34	BLAST
SPEC	901	1030	1.39e0	SMART
coiled coil region	1033	1357	N/A	INTRINSIC
low complexity region	1398	1412	N/A	INTRINSIC
PLEC	1422	1458	3.33e-1	SMART
PLEC	1459	1496	3.76e-9	SMART
PLEC	1497	1534	4.09e-10	SMART
PLEC	1535	1572	2.09e-7	SMART
PLEC	1576	1610	4.83e1	SMART
PLEC	1611	1646	5.67e1	SMART
PLEC	1664	1701	1.22e-8	SMART
PLEC	1702	1739	1.16e-9	SMART
PLEC	1740	1777	1.12e-7	SMART
PLEC	1778	1815	1.56e-6	SMART
PLEC	1819	1853	1.42e0	SMART
PLEC	1869	1906	3.7e-8	SMART
low complexity region	1908	1918	N/A	INTRINSIC
PLEC	1920	1957	3.73e-4	SMART
low complexity region	1978	1994	N/A	INTRINSIC
PLEC	2023	2060	1.46e-6	SMART
PLEC	2061	2098	6.69e-15	SMART
PLEC	2099	2136	1.98e2	SMART
PLEC	2137	2174	2.35e-10	SMART
PLEC	2175	2212	1.39e-3	SMART
low complexity region	2236	2261	N/A	INTRINSIC
low complexity region	2268	2280	N/A	INTRINSIC

Meta Mutation Damage Score

0.0941

Coding Region Coverage

1x: 98.7%
3x: 97.5%
10x: 92.9%
20x: 80.7%

Validation Efficiency

97% (130/134)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that anchors intermediate filaments to desmosomal plaques and forms an obligate component of functional desmosomes. Mutations in this gene are the cause of several cardiomyopathies and keratodermas, including skin fragility-woolly hair syndrome. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2016]
PHENOTYPE: Homozygous targeted null mutants die by embryonic day E6.5 due to instability of desmosomes and tissue integrity; rescue by aggregation with wild-type tetraploid morulae increase embyronic survival with noted major defects in heart muscle, neuroepithelium and epidermis; conditional knockouts that are epidermal-specific have compositionally altered epidermal desmosomes. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 112 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310030G06Rik	G	A	9: 50,740,673	T85M	probably damaging	Het
5430419D17Rik	T	A	7: 131,244,831	Y777*	probably null	Het
Actn1	A	G	12: 80,172,957		probably benign	Het
Afap1l1	A	T	18: 61,737,499	S603T	probably damaging	Het
Ahcy	T	C	2: 155,068,931	Y39C	probably benign	Het
Ankmy2	T	C	12: 36,186,942		probably null	Het
Anxa13	A	T	15: 58,348,807		noncoding transcript	Het
Aoc1	T	C	6: 48,905,786	S221P	possibly damaging	Het
Arhgef10	C	A	8: 14,991,211	A770D	possibly damaging	Het
Arhgef19	A	G	4: 141,254,754	D707G	probably benign	Het
Arhgef3	G	A	14: 27,401,735	R444H	probably damaging	Het
Asphd1	T	C	7: 126,949,099	I11V	probably benign	Het
Atp2b1	A	G	10: 98,994,675	M333V	probably benign	Het
BC051665	T	C	13: 60,785,027	Y40C	probably damaging	Het
Ccdc87	T	A	19: 4,840,313	S278T	probably benign	Het
Chaf1b	G	A	16: 93,901,230	G463D	possibly damaging	Het
Chrna4	T	C	2: 181,029,307	T219A	possibly damaging	Het
Clcnkb	T	G	4: 141,407,095	T584P	possibly damaging	Het
Clptm1l	T	C	13: 73,607,747	S161P	probably benign	Het
Cmya5	T	C	13: 93,094,269	E1437G	possibly damaging	Het
Col13a1	A	T	10: 61,866,426		probably null	Het
Col3a1	T	C	1: 45,345,968	S82P	possibly damaging	Het
Cpeb3	A	T	19: 37,139,082	M383K	probably benign	Het
Cr2	T	A	1: 195,163,314	H111L	probably damaging	Het
Cttnbp2	T	C	6: 18,375,975	S1522G	possibly damaging	Het
Cul3	T	C	1: 80,282,789	D281G	possibly damaging	Het
Cyp2c70	T	G	19: 40,183,982	K72T	probably benign	Het
Cyp39a1	A	T	17: 43,680,129	I110F	probably damaging	Het
Cyp46a1	T	A	12: 108,351,939	M203K	probably null	Het
Cyp8b1	A	T	9: 121,914,958	V436D	possibly damaging	Het
Ddx17	T	C	15: 79,538,565	D324G	probably damaging	Het
Dopey2	A	G	16: 93,770,153	N1274S	probably damaging	Het
Dscaml1	G	A	9: 45,721,333	V1166I	probably benign	Het
Dusp27	C	T	1: 166,099,455	V863M	possibly damaging	Het
Efr3a	T	A	15: 65,854,792		probably null	Het
Egfem1	A	T	3: 29,648,271	N223I	probably benign	Het
Egr2	T	C	10: 67,539,975	S147P	probably damaging	Het
Elmo3	A	G	8: 105,308,301	T408A	probably benign	Het
Flnb	A	G	14: 7,883,908	D378G	probably damaging	Het
Foxj2	T	A	6: 122,833,261	M193K	probably benign	Het
Gm6327	A	G	16: 12,760,156		noncoding transcript	Het
Gm7694	T	C	1: 170,302,766	H21R	probably benign	Het
Gpr107	A	G	2: 31,167,025	D43G	probably damaging	Het
Grid2	T	A	6: 64,429,694	Y679*	probably null	Het
Grin2c	G	A	11: 115,256,074	P432S	possibly damaging	Het
H2-M10.1	A	G	17: 36,325,733	F60L	possibly damaging	Het
Hectd4	A	G	5: 121,301,878	D1147G	possibly damaging	Het
Idua	G	T	5: 108,680,589	A223S	probably benign	Het
Ifi206	T	C	1: 173,486,853	Q7R	probably benign	Het
Itgad	T	A	7: 128,203,234	V986E	probably damaging	Het
Itsn2	G	A	12: 4,650,044	R670H	probably benign	Het
Kdm4a	T	C	4: 118,138,949	E961G	possibly damaging	Het
Klra5	T	A	6: 129,906,622	I91L	probably damaging	Het
Kntc1	A	G	5: 123,772,113	T525A	probably damaging	Het
Lct	A	G	1: 128,294,195	F1536L	probably benign	Het
Lmod1	T	A	1: 135,363,933	D175E	probably benign	Het
Lonrf1	A	C	8: 36,233,972	D361E	probably benign	Het
Lrrc19	T	C	4: 94,638,429	Y297C	probably damaging	Het
Mast4	T	C	13: 102,736,923	E1787G	possibly damaging	Het
Mpp2	G	A	11: 102,060,548	A452V	probably benign	Het
Msh2	T	C	17: 87,718,652	V686A	possibly damaging	Het
Mthfd1	C	T	12: 76,270,419	Q15*	probably null	Het
Mtnr1b	A	T	9: 15,863,142	I207N	probably damaging	Het
Nid2	A	G	14: 19,805,412	T1207A	probably benign	Het
Nin	A	T	12: 70,038,750	V1569D	probably damaging	Het
Nov	T	A	15: 54,749,252	M219K	possibly damaging	Het
Nrcam	T	A	12: 44,537,364		probably benign	Het
Nsd1	T	A	13: 55,246,969	H897Q	probably damaging	Het
Olfr102	A	T	17: 37,313,480	N301K	probably benign	Het
Olfr1364	T	A	13: 21,574,310	I49F	possibly damaging	Het
Olfr77	G	T	9: 19,920,912	K234N	probably benign	Het
Olfr979	A	G	9: 40,001,194	F11S	probably benign	Het
Paip1	T	C	13: 119,451,784		probably benign	Het
Pcnx3	G	A	19: 5,685,347	R484*	probably null	Het
Pdxk	A	G	10: 78,447,980	Y127H	probably damaging	Het
Phf20	T	A	2: 156,287,834	V442E	probably benign	Het
Phlpp1	G	A	1: 106,392,789	D1505N	probably damaging	Het
Pkhd1	T	C	1: 20,347,440	T2496A	probably benign	Het
Pkhd1l1	A	G	15: 44,543,473	T2369A	probably benign	Het
Plod2	T	A	9: 92,603,067		probably benign	Het
Pnpla7	T	A	2: 25,015,251	M617K	possibly damaging	Het
Ppp1r16a	C	T	15: 76,693,669	Q328*	probably null	Het
Prkch	T	A	12: 73,649,357		probably null	Het
Prr12	G	A	7: 45,028,800	H1974Y	unknown	Het
Prr16	A	G	18: 51,302,970	I174V	probably benign	Het
Prss45	A	T	9: 110,838,429	T39S	probably benign	Het
Pum1	T	A	4: 130,718,204	D161E	probably damaging	Het
Rad51ap2	A	G	12: 11,457,112	D345G	probably damaging	Het
Ralgapb	A	G	2: 158,446,199		probably benign	Het
Rasgrp3	A	G	17: 75,500,734	H262R	possibly damaging	Het
Rnf213	T	A	11: 119,436,611	I1809N	probably damaging	Het
Ryr1	A	G	7: 29,062,191	L3177P	probably damaging	Het
Scyl2	C	A	10: 89,650,956	R230L	probably damaging	Het
Sfxn2	T	C	19: 46,582,476		probably benign	Het
Slc18b1	T	C	10: 23,798,741		probably benign	Het
Spata31d1d	T	C	13: 59,728,191	H510R	probably benign	Het
Stab1	A	T	14: 31,150,823	N1109K	probably damaging	Het
Sult3a2	A	G	10: 33,781,977	S47P	probably damaging	Het
Tenm3	T	C	8: 48,228,993	N2518S	possibly damaging	Het
Tex21	G	T	12: 76,206,891	P416Q	probably benign	Het
Tex38	T	C	4: 115,780,306	N100S	probably benign	Het
Thsd4	A	C	9: 60,394,553		probably benign	Het
Ticrr	T	C	7: 79,681,824	V723A	probably damaging	Het
Tmprss15	A	G	16: 79,090,829	V30A	probably benign	Het
Uba3	A	G	6: 97,185,337		probably benign	Het
Ubr1	T	C	2: 120,935,319		probably benign	Het
Uchl4	A	T	9: 64,235,731	I165L	probably benign	Het
Vmn2r112	A	T	17: 22,603,144	T268S	possibly damaging	Het
Wfdc3	T	C	2: 164,744,194		probably benign	Het
Zfp282	T	A	6: 47,892,867	L282Q	probably damaging	Het
Zfp422	A	T	6: 116,626,784	C85S	probably damaging	Het
Zfp790	A	T	7: 29,828,139	Q83L	probably benign	Het

Other mutations in Dsp

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00502:Dsp	APN	13	38197846	missense	probably damaging	0.99
IGL01337:Dsp	APN	13	38192687	missense	probably benign	0.44
IGL01371:Dsp	APN	13	38193617	missense	probably benign	0.13
IGL01473:Dsp	APN	13	38167571	missense	probably damaging	0.99
IGL01660:Dsp	APN	13	38176495	missense	possibly damaging	0.90
IGL01723:Dsp	APN	13	38179084	missense	probably damaging	1.00
IGL01999:Dsp	APN	13	38181186	missense	probably damaging	0.99
IGL02313:Dsp	APN	13	38196523	nonsense	probably null
IGL02833:Dsp	APN	13	38192921	missense	possibly damaging	0.56
IGL03050:Dsp	APN	13	38188445	splice site	probably benign
IGL03353:Dsp	APN	13	38186695	missense	probably damaging	1.00
R0052:Dsp	UTSW	13	38197364	missense	possibly damaging	0.93
R0052:Dsp	UTSW	13	38197364	missense	possibly damaging	0.93
R0078:Dsp	UTSW	13	38196017	missense	probably benign	0.22
R0230:Dsp	UTSW	13	38197705	missense	probably benign	0.03
R0234:Dsp	UTSW	13	38187893	missense	probably benign	0.13
R0234:Dsp	UTSW	13	38187893	missense	probably benign	0.13
R0285:Dsp	UTSW	13	38172794	missense	probably benign
R0326:Dsp	UTSW	13	38192870	nonsense	probably null
R0332:Dsp	UTSW	13	38182228	nonsense	probably null
R0471:Dsp	UTSW	13	38193350	nonsense	probably null
R0567:Dsp	UTSW	13	38192438	missense	probably benign	0.01
R0611:Dsp	UTSW	13	38187741	missense	probably damaging	1.00
R0718:Dsp	UTSW	13	38196764	missense	possibly damaging	0.80
R0926:Dsp	UTSW	13	38183218	missense	probably damaging	0.97
R1078:Dsp	UTSW	13	38183106	splice site	probably benign
R1183:Dsp	UTSW	13	38191740	nonsense	probably null
R1188:Dsp	UTSW	13	38194963	missense	probably damaging	1.00
R1419:Dsp	UTSW	13	38186695	missense	probably damaging	1.00
R1445:Dsp	UTSW	13	38191931	missense	probably damaging	0.98
R1467:Dsp	UTSW	13	38192712	missense	probably benign	0.00
R1467:Dsp	UTSW	13	38192712	missense	probably benign	0.00
R1478:Dsp	UTSW	13	38181138	missense	probably damaging	1.00
R1568:Dsp	UTSW	13	38175147	missense	probably damaging	1.00
R1676:Dsp	UTSW	13	38193374	nonsense	probably null
R1736:Dsp	UTSW	13	38192990	missense	probably benign	0.01
R1776:Dsp	UTSW	13	38196617	missense	probably damaging	0.99
R1829:Dsp	UTSW	13	38193195	missense	probably damaging	1.00
R1878:Dsp	UTSW	13	38164855	missense	possibly damaging	0.53
R2013:Dsp	UTSW	13	38191458	missense	probably damaging	1.00
R2161:Dsp	UTSW	13	38196451	missense	probably damaging	1.00
R2187:Dsp	UTSW	13	38176407	missense	probably damaging	1.00
R2295:Dsp	UTSW	13	38197046	missense	probably benign	0.28
R2495:Dsp	UTSW	13	38193477	missense	possibly damaging	0.91
R2566:Dsp	UTSW	13	38196404	missense	probably damaging	1.00
R2888:Dsp	UTSW	13	38192248	missense	possibly damaging	0.92
R3012:Dsp	UTSW	13	38193342	missense	possibly damaging	0.61
R3614:Dsp	UTSW	13	38177199	missense	probably damaging	0.98
R3725:Dsp	UTSW	13	38194689	splice site	probably null
R3725:Dsp	UTSW	13	38197618	missense	probably benign	0.00
R3797:Dsp	UTSW	13	38177284	critical splice donor site	probably null
R3841:Dsp	UTSW	13	38197705	missense	probably benign
R4030:Dsp	UTSW	13	38191428	missense	possibly damaging	0.84
R4124:Dsp	UTSW	13	38186713	missense	probably damaging	1.00
R4279:Dsp	UTSW	13	38185231	missense	probably damaging	1.00
R4334:Dsp	UTSW	13	38196664	missense	possibly damaging	0.46
R4419:Dsp	UTSW	13	38195132	missense	probably damaging	1.00
R4615:Dsp	UTSW	13	38191632	missense	probably damaging	0.98
R4627:Dsp	UTSW	13	38168641	missense	probably benign	0.01
R4639:Dsp	UTSW	13	38196784	missense	probably damaging	1.00
R4687:Dsp	UTSW	13	38191619	missense	probably damaging	1.00
R4735:Dsp	UTSW	13	38196040	missense	probably damaging	0.99
R4746:Dsp	UTSW	13	38195104	missense	possibly damaging	0.51
R4772:Dsp	UTSW	13	38167528	nonsense	probably null
R4830:Dsp	UTSW	13	38192864	missense	probably benign
R4850:Dsp	UTSW	13	38192469	missense	probably damaging	1.00
R4959:Dsp	UTSW	13	38191710	missense	probably benign	0.41
R4963:Dsp	UTSW	13	38197870	missense	probably damaging	0.99
R4969:Dsp	UTSW	13	38192910	missense	probably benign	0.00
R4978:Dsp	UTSW	13	38182234	missense	probably damaging	1.00
R4989:Dsp	UTSW	13	38197702	missense	possibly damaging	0.93
R5068:Dsp	UTSW	13	38197123	missense	possibly damaging	0.78
R5069:Dsp	UTSW	13	38197123	missense	possibly damaging	0.78
R5070:Dsp	UTSW	13	38197123	missense	possibly damaging	0.78
R5133:Dsp	UTSW	13	38197702	missense	possibly damaging	0.93
R5138:Dsp	UTSW	13	38183298	missense	probably benign	0.37
R5138:Dsp	UTSW	13	38195845	missense	possibly damaging	0.50
R5153:Dsp	UTSW	13	38182306	missense	probably damaging	1.00
R5199:Dsp	UTSW	13	38192902	nonsense	probably null
R5226:Dsp	UTSW	13	38186770	missense	probably damaging	0.99
R5265:Dsp	UTSW	13	38195183	missense	possibly damaging	0.95
R5371:Dsp	UTSW	13	38194889	missense	probably damaging	0.97
R5484:Dsp	UTSW	13	38184038	missense	possibly damaging	0.48
R5534:Dsp	UTSW	13	38195842	missense	probably benign	0.01
R5569:Dsp	UTSW	13	38192652	missense	probably benign	0.01
R5854:Dsp	UTSW	13	38167501	splice site	probably null
R5910:Dsp	UTSW	13	38192469	missense	possibly damaging	0.95
R5929:Dsp	UTSW	13	38195434	missense	possibly damaging	0.92
R5940:Dsp	UTSW	13	38196026	missense	possibly damaging	0.70
R5948:Dsp	UTSW	13	38195401	missense	possibly damaging	0.95
R5955:Dsp	UTSW	13	38194958	missense	possibly damaging	0.73
R5970:Dsp	UTSW	13	38195702	missense	possibly damaging	0.93
R6054:Dsp	UTSW	13	38167609	missense	probably benign	0.00
R6113:Dsp	UTSW	13	38192047	missense	probably damaging	1.00
R6139:Dsp	UTSW	13	38192406	missense	probably damaging	0.97
R6328:Dsp	UTSW	13	38197006	nonsense	probably null
R6527:Dsp	UTSW	13	38195873	missense	probably damaging	1.00
R6573:Dsp	UTSW	13	38196862	missense	probably damaging	1.00
R6628:Dsp	UTSW	13	38167622	missense	possibly damaging	0.73
R6738:Dsp	UTSW	13	38192210	missense	possibly damaging	0.87
R6898:Dsp	UTSW	13	38192217	missense	possibly damaging	0.59
R6919:Dsp	UTSW	13	38167655	missense	possibly damaging	0.84
R6951:Dsp	UTSW	13	38167646	missense	possibly damaging	0.95
R7017:Dsp	UTSW	13	38186707	missense	probably benign	0.02
R7022:Dsp	UTSW	13	38191740	missense	probably benign	0.06
R7135:Dsp	UTSW	13	38179073	missense	probably damaging	1.00
R7192:Dsp	UTSW	13	38195593	missense	probably benign	0.09
R7211:Dsp	UTSW	13	38188535	critical splice donor site	probably null
R7251:Dsp	UTSW	13	38193548	missense	probably benign	0.02
R7326:Dsp	UTSW	13	38192883	missense	probably benign	0.01
R7369:Dsp	UTSW	13	38197525	missense	possibly damaging	0.82
R7376:Dsp	UTSW	13	38172843	missense	probably damaging	1.00
R7406:Dsp	UTSW	13	38197196	missense	possibly damaging	0.63
R7439:Dsp	UTSW	13	38176502	critical splice donor site	probably null
R7439:Dsp	UTSW	13	38195449	missense	probably benign	0.00
R7441:Dsp	UTSW	13	38195449	missense	probably benign	0.00
R7477:Dsp	UTSW	13	38172863	missense	probably damaging	1.00
R7535:Dsp	UTSW	13	38192789	missense	probably benign	0.05
R7558:Dsp	UTSW	13	38168766	missense	probably benign	0.02
R7600:Dsp	UTSW	13	38191715	missense	probably damaging	1.00
R7616:Dsp	UTSW	13	38191482	missense	probably damaging	0.98
R7702:Dsp	UTSW	13	38175207	missense	possibly damaging	0.83
R7738:Dsp	UTSW	13	38185175	missense	probably damaging	0.97
R7815:Dsp	UTSW	13	38191470	missense	probably benign	0.31
R7882:Dsp	UTSW	13	38184018	missense	possibly damaging	0.76
R7917:Dsp	UTSW	13	38167639	nonsense	probably null
R7971:Dsp	UTSW	13	38192523	missense	probably damaging	0.97
R8104:Dsp	UTSW	13	38168624	missense	probably benign	0.03
R8176:Dsp	UTSW	13	38192810	missense	possibly damaging	0.56
R8303:Dsp	UTSW	13	38197343	missense	probably benign
R8323:Dsp	UTSW	13	38172830	missense	possibly damaging	0.80
R8326:Dsp	UTSW	13	38191635	missense	probably damaging	1.00
R8358:Dsp	UTSW	13	38192481	missense	possibly damaging	0.92
R8410:Dsp	UTSW	13	38196815	missense	possibly damaging	0.94
R8552:Dsp	UTSW	13	38185141	missense	probably damaging	0.98
R8713:Dsp	UTSW	13	38168725	missense	probably damaging	0.99
R8801:Dsp	UTSW	13	38197526	missense	possibly damaging	0.81
R8900:Dsp	UTSW	13	38181179	missense	probably damaging	0.99
R8901:Dsp	UTSW	13	38181179	missense	probably damaging	0.99
R8968:Dsp	UTSW	13	38151620	missense	possibly damaging	0.83
R9014:Dsp	UTSW	13	38192724	missense	possibly damaging	0.83
R9021:Dsp	UTSW	13	38196832	missense	possibly damaging	0.61
R9030:Dsp	UTSW	13	38168697	missense	probably damaging	1.00
R9124:Dsp	UTSW	13	38193300	missense	probably benign	0.42
R9129:Dsp	UTSW	13	38193150	missense	probably benign	0.09
R9143:Dsp	UTSW	13	38193361	missense	probably benign	0.05
R9450:Dsp	UTSW	13	38192403	missense	probably damaging	1.00
R9488:Dsp	UTSW	13	38193242	missense	probably benign	0.04
R9514:Dsp	UTSW	13	38187805	missense	probably benign	0.02
R9789:Dsp	UTSW	13	38183961	missense	probably benign	0.03
R9792:Dsp	UTSW	13	38195518	missense	possibly damaging	0.87
X0023:Dsp	UTSW	13	38197684	missense	probably benign	0.00
X0024:Dsp	UTSW	13	38193255	missense	probably benign	0.04
X0027:Dsp	UTSW	13	38186646	missense	possibly damaging	0.68
X0067:Dsp	UTSW	13	38182312	missense	possibly damaging	0.85
Z1176:Dsp	UTSW	13	38197190	missense	possibly damaging	0.81
Z1177:Dsp	UTSW	13	38151689	missense	probably benign	0.01
Z1177:Dsp	UTSW	13	38192854	frame shift	probably null

Predicted Primers

PCR Primer
(F):5'- TCCCCATCGGAATGAGAAGCTCAC -3'
(R):5'- TCTGTACTGACAGCAGGAGCAGAC -3'

Sequencing Primer
(F):5'- AGCTCACTGTGGACAATGC -3'
(R):5'- GCAGGAGCAGACCCGTG -3'

Posted On

2014-04-13