Incidental Mutation 'R1572:Stab1'
ID 170900
Institutional Source Beutler Lab
Gene Symbol Stab1
Ensembl Gene ENSMUSG00000042286
Gene Name stabilin 1
Synonyms MS-1
MMRRC Submission 039611-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1572 (G1)
Quality Score 122
Status Validated
Chromosome 14
Chromosomal Location 31139013-31168641 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 31150823 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 1109 (N1109K)
Ref Sequence ENSEMBL: ENSMUSP00000046199 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036618]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000036618
AA Change: N1109K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000046199
Gene: ENSMUSG00000042286
AA Change: N1109K

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
EGF 112 149 6.65e-2 SMART
EGF 160 194 2.28e0 SMART
EGF 199 232 1.4e0 SMART
EGF 236 272 4.97e-1 SMART
EGF 276 319 1.95e1 SMART
EGF_like 321 357 5.03e1 SMART
low complexity region 400 413 N/A INTRINSIC
Blast:FAS1 414 501 2e-52 BLAST
FAS1 543 645 1.35e-24 SMART
EGF_like 780 817 5.45e1 SMART
EGF 822 861 1.08e-1 SMART
EGF 865 904 3.15e-3 SMART
EGF 908 947 1.3e1 SMART
EGF 951 989 1.47e1 SMART
FAS1 1023 1122 1.3e-17 SMART
FAS1 1165 1257 2.94e0 SMART
EGF 1332 1369 1.4e0 SMART
EGF 1379 1413 1.88e-1 SMART
EGF 1420 1455 6.02e0 SMART
EGF 1459 1497 3.82e-2 SMART
EGF 1501 1540 2.05e-2 SMART
EGF 1544 1583 2.25e1 SMART
FAS1 1616 1712 1.61e-22 SMART
FAS1 1763 1868 2.12e-17 SMART
EGF 1970 2007 1.26e-2 SMART
EGF 2017 2051 1.61e0 SMART
EGF 2059 2090 2.45e0 SMART
EGF 2094 2131 3.46e0 SMART
EGF 2135 2174 3.82e-2 SMART
LINK 2206 2301 8.55e-49 SMART
FAS1 2367 2462 2.06e-6 SMART
transmembrane domain 2476 2498 N/A INTRINSIC
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 97.5%
  • 10x: 92.9%
  • 20x: 80.7%
Validation Efficiency 97% (130/134)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large, transmembrane receptor protein which may function in angiogenesis, lymphocyte homing, cell adhesion, or receptor scavenging. The protein contains 7 fasciclin, 16 epidermal growth factor (EGF)-like, and 2 laminin-type EGF-like domains as well as a C-type lectin-like hyaluronan-binding Link module. The protein is primarily expressed on sinusoidal endothelial cells of liver, spleen, and lymph node. The receptor has been shown to endocytose ligands such as low density lipoprotein, Gram-positive and Gram-negative bacteria, and advanced glycosylation end products. Supporting its possible role as a scavenger receptor, the protein rapidly cycles between the plasma membrane and early endosomes. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit no physical or behavioral abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 112 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310030G06Rik G A 9: 50,740,673 (GRCm38) T85M probably damaging Het
5430419D17Rik T A 7: 131,244,831 (GRCm38) Y777* probably null Het
Actn1 A G 12: 80,172,957 (GRCm38) probably benign Het
Afap1l1 A T 18: 61,737,499 (GRCm38) S603T probably damaging Het
Ahcy T C 2: 155,068,931 (GRCm38) Y39C probably benign Het
Ankmy2 T C 12: 36,186,942 (GRCm38) probably null Het
Anxa13 A T 15: 58,348,807 (GRCm38) noncoding transcript Het
Aoc1 T C 6: 48,905,786 (GRCm38) S221P possibly damaging Het
Arhgef10 C A 8: 14,991,211 (GRCm38) A770D possibly damaging Het
Arhgef19 A G 4: 141,254,754 (GRCm38) D707G probably benign Het
Arhgef3 G A 14: 27,401,735 (GRCm38) R444H probably damaging Het
Asphd1 T C 7: 126,949,099 (GRCm38) I11V probably benign Het
Atp2b1 A G 10: 98,994,675 (GRCm38) M333V probably benign Het
BC051665 T C 13: 60,785,027 (GRCm38) Y40C probably damaging Het
Ccdc87 T A 19: 4,840,313 (GRCm38) S278T probably benign Het
Chaf1b G A 16: 93,901,230 (GRCm38) G463D possibly damaging Het
Chrna4 T C 2: 181,029,307 (GRCm38) T219A possibly damaging Het
Clcnkb T G 4: 141,407,095 (GRCm38) T584P possibly damaging Het
Clptm1l T C 13: 73,607,747 (GRCm38) S161P probably benign Het
Cmya5 T C 13: 93,094,269 (GRCm38) E1437G possibly damaging Het
Col13a1 A T 10: 61,866,426 (GRCm38) probably null Het
Col3a1 T C 1: 45,345,968 (GRCm38) S82P possibly damaging Het
Cpeb3 A T 19: 37,139,082 (GRCm38) M383K probably benign Het
Cr2 T A 1: 195,163,314 (GRCm38) H111L probably damaging Het
Cttnbp2 T C 6: 18,375,975 (GRCm38) S1522G possibly damaging Het
Cul3 T C 1: 80,282,789 (GRCm38) D281G possibly damaging Het
Cyp2c70 T G 19: 40,183,982 (GRCm38) K72T probably benign Het
Cyp39a1 A T 17: 43,680,129 (GRCm38) I110F probably damaging Het
Cyp46a1 T A 12: 108,351,939 (GRCm38) M203K probably null Het
Cyp8b1 A T 9: 121,914,958 (GRCm38) V436D possibly damaging Het
Ddx17 T C 15: 79,538,565 (GRCm38) D324G probably damaging Het
Dopey2 A G 16: 93,770,153 (GRCm38) N1274S probably damaging Het
Dscaml1 G A 9: 45,721,333 (GRCm38) V1166I probably benign Het
Dsp T C 13: 38,195,738 (GRCm38) V1554A probably damaging Het
Dusp27 C T 1: 166,099,455 (GRCm38) V863M possibly damaging Het
Efr3a T A 15: 65,854,792 (GRCm38) probably null Het
Egfem1 A T 3: 29,648,271 (GRCm38) N223I probably benign Het
Egr2 T C 10: 67,539,975 (GRCm38) S147P probably damaging Het
Elmo3 A G 8: 105,308,301 (GRCm38) T408A probably benign Het
Flnb A G 14: 7,883,908 (GRCm38) D378G probably damaging Het
Foxj2 T A 6: 122,833,261 (GRCm38) M193K probably benign Het
Gm6327 A G 16: 12,760,156 (GRCm38) noncoding transcript Het
Gm7694 T C 1: 170,302,766 (GRCm38) H21R probably benign Het
Gpr107 A G 2: 31,167,025 (GRCm38) D43G probably damaging Het
Grid2 T A 6: 64,429,694 (GRCm38) Y679* probably null Het
Grin2c G A 11: 115,256,074 (GRCm38) P432S possibly damaging Het
H2-M10.1 A G 17: 36,325,733 (GRCm38) F60L possibly damaging Het
Hectd4 A G 5: 121,301,878 (GRCm38) D1147G possibly damaging Het
Idua G T 5: 108,680,589 (GRCm38) A223S probably benign Het
Ifi206 T C 1: 173,486,853 (GRCm38) Q7R probably benign Het
Itgad T A 7: 128,203,234 (GRCm38) V986E probably damaging Het
Itsn2 G A 12: 4,650,044 (GRCm38) R670H probably benign Het
Kdm4a T C 4: 118,138,949 (GRCm38) E961G possibly damaging Het
Klra5 T A 6: 129,906,622 (GRCm38) I91L probably damaging Het
Kntc1 A G 5: 123,772,113 (GRCm38) T525A probably damaging Het
Lct A G 1: 128,294,195 (GRCm38) F1536L probably benign Het
Lmod1 T A 1: 135,363,933 (GRCm38) D175E probably benign Het
Lonrf1 A C 8: 36,233,972 (GRCm38) D361E probably benign Het
Lrrc19 T C 4: 94,638,429 (GRCm38) Y297C probably damaging Het
Mast4 T C 13: 102,736,923 (GRCm38) E1787G possibly damaging Het
Mpp2 G A 11: 102,060,548 (GRCm38) A452V probably benign Het
Msh2 T C 17: 87,718,652 (GRCm38) V686A possibly damaging Het
Mthfd1 C T 12: 76,270,419 (GRCm38) Q15* probably null Het
Mtnr1b A T 9: 15,863,142 (GRCm38) I207N probably damaging Het
Nid2 A G 14: 19,805,412 (GRCm38) T1207A probably benign Het
Nin A T 12: 70,038,750 (GRCm38) V1569D probably damaging Het
Nov T A 15: 54,749,252 (GRCm38) M219K possibly damaging Het
Nrcam T A 12: 44,537,364 (GRCm38) probably benign Het
Nsd1 T A 13: 55,246,969 (GRCm38) H897Q probably damaging Het
Olfr102 A T 17: 37,313,480 (GRCm38) N301K probably benign Het
Olfr1364 T A 13: 21,574,310 (GRCm38) I49F possibly damaging Het
Olfr77 G T 9: 19,920,912 (GRCm38) K234N probably benign Het
Olfr979 A G 9: 40,001,194 (GRCm38) F11S probably benign Het
Paip1 T C 13: 119,451,784 (GRCm38) probably benign Het
Pcnx3 G A 19: 5,685,347 (GRCm38) R484* probably null Het
Pdxk A G 10: 78,447,980 (GRCm38) Y127H probably damaging Het
Phf20 T A 2: 156,287,834 (GRCm38) V442E probably benign Het
Phlpp1 G A 1: 106,392,789 (GRCm38) D1505N probably damaging Het
Pkhd1 T C 1: 20,347,440 (GRCm38) T2496A probably benign Het
Pkhd1l1 A G 15: 44,543,473 (GRCm38) T2369A probably benign Het
Plod2 T A 9: 92,603,067 (GRCm38) probably benign Het
Pnpla7 T A 2: 25,015,251 (GRCm38) M617K possibly damaging Het
Ppp1r16a C T 15: 76,693,669 (GRCm38) Q328* probably null Het
Prkch T A 12: 73,649,357 (GRCm38) probably null Het
Prr12 G A 7: 45,028,800 (GRCm38) H1974Y unknown Het
Prr16 A G 18: 51,302,970 (GRCm38) I174V probably benign Het
Prss45 A T 9: 110,838,429 (GRCm38) T39S probably benign Het
Pum1 T A 4: 130,718,204 (GRCm38) D161E probably damaging Het
Rad51ap2 A G 12: 11,457,112 (GRCm38) D345G probably damaging Het
Ralgapb A G 2: 158,446,199 (GRCm38) probably benign Het
Rasgrp3 A G 17: 75,500,734 (GRCm38) H262R possibly damaging Het
Rnf213 T A 11: 119,436,611 (GRCm38) I1809N probably damaging Het
Ryr1 A G 7: 29,062,191 (GRCm38) L3177P probably damaging Het
Scyl2 C A 10: 89,650,956 (GRCm38) R230L probably damaging Het
Sfxn2 T C 19: 46,582,476 (GRCm38) probably benign Het
Slc18b1 T C 10: 23,798,741 (GRCm38) probably benign Het
Spata31d1d T C 13: 59,728,191 (GRCm38) H510R probably benign Het
Sult3a2 A G 10: 33,781,977 (GRCm38) S47P probably damaging Het
Tenm3 T C 8: 48,228,993 (GRCm38) N2518S possibly damaging Het
Tex21 G T 12: 76,206,891 (GRCm38) P416Q probably benign Het
Tex38 T C 4: 115,780,306 (GRCm38) N100S probably benign Het
Thsd4 A C 9: 60,394,553 (GRCm38) probably benign Het
Ticrr T C 7: 79,681,824 (GRCm38) V723A probably damaging Het
Tmprss15 A G 16: 79,090,829 (GRCm38) V30A probably benign Het
Uba3 A G 6: 97,185,337 (GRCm38) probably benign Het
Ubr1 T C 2: 120,935,319 (GRCm38) probably benign Het
Uchl4 A T 9: 64,235,731 (GRCm38) I165L probably benign Het
Vmn2r112 A T 17: 22,603,144 (GRCm38) T268S possibly damaging Het
Wfdc3 T C 2: 164,744,194 (GRCm38) probably benign Het
Zfp282 T A 6: 47,892,867 (GRCm38) L282Q probably damaging Het
Zfp422 A T 6: 116,626,784 (GRCm38) C85S probably damaging Het
Zfp790 A T 7: 29,828,139 (GRCm38) Q83L probably benign Het
Other mutations in Stab1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Stab1 APN 14 31,161,357 (GRCm38) missense probably benign 0.01
IGL00323:Stab1 APN 14 31,139,306 (GRCm38) missense probably benign 0.04
IGL00515:Stab1 APN 14 31,159,729 (GRCm38) missense probably benign 0.20
IGL00844:Stab1 APN 14 31,147,066 (GRCm38) missense probably damaging 1.00
IGL01374:Stab1 APN 14 31,147,075 (GRCm38) missense probably damaging 1.00
IGL01384:Stab1 APN 14 31,150,408 (GRCm38) missense probably benign
IGL01431:Stab1 APN 14 31,148,995 (GRCm38) missense probably benign 0.06
IGL01787:Stab1 APN 14 31,139,808 (GRCm38) missense probably damaging 1.00
IGL02128:Stab1 APN 14 31,150,441 (GRCm38) missense probably damaging 1.00
IGL02138:Stab1 APN 14 31,143,513 (GRCm38) critical splice donor site probably null
IGL02256:Stab1 APN 14 31,141,592 (GRCm38) missense probably damaging 1.00
IGL02340:Stab1 APN 14 31,140,410 (GRCm38) missense probably damaging 0.96
IGL02507:Stab1 APN 14 31,139,210 (GRCm38) unclassified probably benign
IGL02695:Stab1 APN 14 31,159,271 (GRCm38) missense probably damaging 1.00
IGL02755:Stab1 APN 14 31,139,638 (GRCm38) missense probably benign 0.01
IGL02870:Stab1 APN 14 31,139,397 (GRCm38) missense probably benign 0.00
IGL02884:Stab1 APN 14 31,150,143 (GRCm38) splice site probably null
IGL03035:Stab1 APN 14 31,147,769 (GRCm38) missense probably benign 0.00
IGL03267:Stab1 APN 14 31,142,729 (GRCm38) missense probably damaging 1.00
IGL03286:Stab1 APN 14 31,159,326 (GRCm38) splice site probably benign
IGL03366:Stab1 APN 14 31,150,263 (GRCm38) missense possibly damaging 0.58
IGL03412:Stab1 APN 14 31,154,407 (GRCm38) missense probably benign 0.42
R0906_Stab1_335 UTSW 14 31,145,249 (GRCm38) missense probably benign 0.19
R5086_Stab1_467 UTSW 14 31,159,304 (GRCm38) missense probably damaging 1.00
IGL02835:Stab1 UTSW 14 31,146,024 (GRCm38) critical splice donor site probably null
K7371:Stab1 UTSW 14 31,150,249 (GRCm38) missense probably damaging 1.00
R0053:Stab1 UTSW 14 31,140,687 (GRCm38) missense possibly damaging 0.57
R0053:Stab1 UTSW 14 31,140,687 (GRCm38) missense possibly damaging 0.57
R0066:Stab1 UTSW 14 31,157,070 (GRCm38) splice site probably benign
R0066:Stab1 UTSW 14 31,157,070 (GRCm38) splice site probably benign
R0363:Stab1 UTSW 14 31,159,008 (GRCm38) splice site probably benign
R0387:Stab1 UTSW 14 31,148,101 (GRCm38) missense probably benign 0.00
R0391:Stab1 UTSW 14 31,143,418 (GRCm38) missense probably benign 0.21
R0513:Stab1 UTSW 14 31,148,945 (GRCm38) missense probably benign 0.08
R0546:Stab1 UTSW 14 31,139,550 (GRCm38) missense possibly damaging 0.92
R0825:Stab1 UTSW 14 31,152,600 (GRCm38) missense probably benign 0.16
R0906:Stab1 UTSW 14 31,145,249 (GRCm38) missense probably benign 0.19
R0963:Stab1 UTSW 14 31,147,274 (GRCm38) missense probably damaging 0.97
R1219:Stab1 UTSW 14 31,140,621 (GRCm38) splice site probably null
R1234:Stab1 UTSW 14 31,150,236 (GRCm38) missense probably damaging 1.00
R1260:Stab1 UTSW 14 31,151,889 (GRCm38) missense probably damaging 1.00
R1400:Stab1 UTSW 14 31,139,830 (GRCm38) missense possibly damaging 0.92
R1405:Stab1 UTSW 14 31,149,001 (GRCm38) missense probably benign 0.19
R1405:Stab1 UTSW 14 31,149,001 (GRCm38) missense probably benign 0.19
R1440:Stab1 UTSW 14 31,151,690 (GRCm38) nonsense probably null
R1472:Stab1 UTSW 14 31,141,586 (GRCm38) missense probably benign 0.01
R1474:Stab1 UTSW 14 31,149,861 (GRCm38) missense probably benign 0.45
R1475:Stab1 UTSW 14 31,163,828 (GRCm38) missense probably benign
R1509:Stab1 UTSW 14 31,151,584 (GRCm38) splice site probably benign
R1551:Stab1 UTSW 14 31,160,499 (GRCm38) missense probably benign 0.00
R1633:Stab1 UTSW 14 31,150,380 (GRCm38) splice site probably null
R1719:Stab1 UTSW 14 31,146,028 (GRCm38) nonsense probably null
R1733:Stab1 UTSW 14 31,145,303 (GRCm38) missense probably damaging 1.00
R1763:Stab1 UTSW 14 31,168,416 (GRCm38) missense probably benign 0.04
R1808:Stab1 UTSW 14 31,141,144 (GRCm38) missense possibly damaging 0.80
R1816:Stab1 UTSW 14 31,157,465 (GRCm38) missense probably benign 0.03
R1853:Stab1 UTSW 14 31,140,463 (GRCm38) missense probably damaging 1.00
R1891:Stab1 UTSW 14 31,141,330 (GRCm38) missense probably benign 0.07
R1984:Stab1 UTSW 14 31,150,648 (GRCm38) missense probably benign 0.20
R1998:Stab1 UTSW 14 31,162,153 (GRCm38) nonsense probably null
R2165:Stab1 UTSW 14 31,168,435 (GRCm38) missense probably benign 0.20
R2191:Stab1 UTSW 14 31,159,270 (GRCm38) missense probably damaging 1.00
R2191:Stab1 UTSW 14 31,142,800 (GRCm38) missense probably benign 0.03
R2233:Stab1 UTSW 14 31,161,880 (GRCm38) missense probably benign 0.08
R2303:Stab1 UTSW 14 31,146,070 (GRCm38) missense probably damaging 1.00
R2496:Stab1 UTSW 14 31,161,463 (GRCm38) missense probably damaging 1.00
R2504:Stab1 UTSW 14 31,163,040 (GRCm38) critical splice donor site probably null
R2519:Stab1 UTSW 14 31,154,872 (GRCm38) missense probably damaging 1.00
R2926:Stab1 UTSW 14 31,161,799 (GRCm38) missense probably damaging 1.00
R4025:Stab1 UTSW 14 31,154,952 (GRCm38) missense possibly damaging 0.46
R4113:Stab1 UTSW 14 31,168,479 (GRCm38) missense probably damaging 0.98
R4258:Stab1 UTSW 14 31,154,672 (GRCm38) missense possibly damaging 0.92
R4588:Stab1 UTSW 14 31,157,445 (GRCm38) missense probably benign 0.01
R4644:Stab1 UTSW 14 31,140,487 (GRCm38) unclassified probably benign
R4660:Stab1 UTSW 14 31,154,915 (GRCm38) missense possibly damaging 0.91
R4801:Stab1 UTSW 14 31,141,371 (GRCm38) nonsense probably null
R4802:Stab1 UTSW 14 31,141,371 (GRCm38) nonsense probably null
R4870:Stab1 UTSW 14 31,142,043 (GRCm38) missense probably benign 0.13
R4872:Stab1 UTSW 14 31,140,393 (GRCm38) missense probably damaging 1.00
R4881:Stab1 UTSW 14 31,143,672 (GRCm38) missense probably benign 0.32
R4941:Stab1 UTSW 14 31,151,571 (GRCm38) missense probably benign 0.00
R5061:Stab1 UTSW 14 31,163,099 (GRCm38) missense probably damaging 1.00
R5086:Stab1 UTSW 14 31,159,304 (GRCm38) missense probably damaging 1.00
R5086:Stab1 UTSW 14 31,143,624 (GRCm38) missense probably damaging 1.00
R5087:Stab1 UTSW 14 31,159,304 (GRCm38) missense probably damaging 1.00
R5092:Stab1 UTSW 14 31,145,855 (GRCm38) missense probably benign 0.01
R5102:Stab1 UTSW 14 31,148,017 (GRCm38) critical splice donor site probably null
R5107:Stab1 UTSW 14 31,163,795 (GRCm38) splice site probably null
R5195:Stab1 UTSW 14 31,140,521 (GRCm38) unclassified probably benign
R5217:Stab1 UTSW 14 31,159,519 (GRCm38) missense probably benign 0.25
R5285:Stab1 UTSW 14 31,143,476 (GRCm38) unclassified probably benign
R5327:Stab1 UTSW 14 31,161,836 (GRCm38) nonsense probably null
R5647:Stab1 UTSW 14 31,157,440 (GRCm38) nonsense probably null
R5696:Stab1 UTSW 14 31,160,221 (GRCm38) missense probably benign
R5996:Stab1 UTSW 14 31,139,551 (GRCm38) missense probably benign 0.39
R6016:Stab1 UTSW 14 31,158,993 (GRCm38) missense probably damaging 1.00
R6017:Stab1 UTSW 14 31,141,544 (GRCm38) missense probably benign 0.00
R6174:Stab1 UTSW 14 31,162,519 (GRCm38) nonsense probably null
R6366:Stab1 UTSW 14 31,141,438 (GRCm38) missense probably benign 0.10
R6754:Stab1 UTSW 14 31,141,081 (GRCm38) missense probably benign
R6788:Stab1 UTSW 14 31,139,160 (GRCm38) missense probably damaging 1.00
R6898:Stab1 UTSW 14 31,158,963 (GRCm38) missense probably benign 0.00
R7124:Stab1 UTSW 14 31,160,867 (GRCm38) missense possibly damaging 0.94
R7145:Stab1 UTSW 14 31,145,073 (GRCm38) critical splice donor site probably null
R7153:Stab1 UTSW 14 31,160,584 (GRCm38) missense probably benign 0.16
R7213:Stab1 UTSW 14 31,143,673 (GRCm38) missense probably benign
R7215:Stab1 UTSW 14 31,160,797 (GRCm38) missense possibly damaging 0.93
R7319:Stab1 UTSW 14 31,140,826 (GRCm38) missense probably damaging 1.00
R7389:Stab1 UTSW 14 31,147,239 (GRCm38) missense probably benign 0.00
R7400:Stab1 UTSW 14 31,157,384 (GRCm38) missense probably null 1.00
R7427:Stab1 UTSW 14 31,159,259 (GRCm38) missense probably benign 0.00
R7428:Stab1 UTSW 14 31,159,259 (GRCm38) missense probably benign 0.00
R7484:Stab1 UTSW 14 31,160,317 (GRCm38) missense probably benign 0.00
R7568:Stab1 UTSW 14 31,152,595 (GRCm38) missense probably damaging 1.00
R7574:Stab1 UTSW 14 31,154,665 (GRCm38) missense probably benign
R7619:Stab1 UTSW 14 31,145,237 (GRCm38) missense probably benign
R7623:Stab1 UTSW 14 31,140,621 (GRCm38) missense probably benign 0.03
R7721:Stab1 UTSW 14 31,141,456 (GRCm38) missense possibly damaging 0.48
R7869:Stab1 UTSW 14 31,154,472 (GRCm38) missense probably benign 0.01
R7936:Stab1 UTSW 14 31,157,415 (GRCm38) missense possibly damaging 0.88
R7956:Stab1 UTSW 14 31,160,024 (GRCm38) missense probably benign 0.02
R7973:Stab1 UTSW 14 31,159,633 (GRCm38) critical splice donor site probably null
R8059:Stab1 UTSW 14 31,160,241 (GRCm38) missense probably benign 0.02
R8116:Stab1 UTSW 14 31,158,953 (GRCm38) missense possibly damaging 0.80
R8304:Stab1 UTSW 14 31,148,954 (GRCm38) missense probably benign 0.14
R8368:Stab1 UTSW 14 31,148,411 (GRCm38) missense possibly damaging 0.91
R8495:Stab1 UTSW 14 31,155,833 (GRCm38) missense probably damaging 1.00
R8513:Stab1 UTSW 14 31,149,790 (GRCm38) critical splice donor site probably null
R8544:Stab1 UTSW 14 31,163,051 (GRCm38) nonsense probably null
R8671:Stab1 UTSW 14 31,157,408 (GRCm38) missense probably damaging 1.00
R8885:Stab1 UTSW 14 31,161,814 (GRCm38) missense possibly damaging 0.79
R8974:Stab1 UTSW 14 31,160,822 (GRCm38) missense probably benign
R9022:Stab1 UTSW 14 31,160,269 (GRCm38) missense probably benign 0.01
R9059:Stab1 UTSW 14 31,154,848 (GRCm38) missense probably benign 0.01
R9226:Stab1 UTSW 14 31,145,855 (GRCm38) missense probably benign 0.00
R9272:Stab1 UTSW 14 31,145,341 (GRCm38) missense probably benign 0.05
R9388:Stab1 UTSW 14 31,154,355 (GRCm38) missense probably damaging 1.00
R9401:Stab1 UTSW 14 31,161,112 (GRCm38) missense probably benign
R9433:Stab1 UTSW 14 31,143,574 (GRCm38) missense probably benign 0.00
R9450:Stab1 UTSW 14 31,162,939 (GRCm38) missense possibly damaging 0.62
R9505:Stab1 UTSW 14 31,155,765 (GRCm38) missense probably damaging 1.00
R9570:Stab1 UTSW 14 31,142,681 (GRCm38) missense probably benign 0.01
R9624:Stab1 UTSW 14 31,141,388 (GRCm38) missense
R9694:Stab1 UTSW 14 31,154,944 (GRCm38) missense probably benign 0.06
R9723:Stab1 UTSW 14 31,163,891 (GRCm38) missense probably benign 0.10
X0026:Stab1 UTSW 14 31,162,191 (GRCm38) missense possibly damaging 0.91
Z1176:Stab1 UTSW 14 31,150,660 (GRCm38) missense probably benign 0.00
Z1176:Stab1 UTSW 14 31,142,038 (GRCm38) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CCTGGGAACTCATTCCCCTTGAAC -3'
(R):5'- TCATTAGAAGCTGTGTATGCCGCC -3'

Sequencing Primer
(F):5'- GAACGAGCCTCCTTTATACCTTTAG -3'
(R):5'- TGTGTATGCCGCCAATGC -3'
Posted On 2014-04-13