Mutagenetix > Incidental Mutation

Incidental Mutation 'R1572:Pkhd1l1'

170901

Institutional Source

Beutler Lab

Gene Symbol

Pkhd1l1

Ensembl Gene

ENSMUSG00000038725

Gene Name

polycystic kidney and hepatic disease 1-like 1

Synonyms

PKHDL1, D86 mRNA, fibrocystin L

MMRRC Submission

039611-MU

Accession Numbers

Genbank: NM_138674; MGI: 2183153

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1572 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

44457494-44601369 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 44543473 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 2369 (T2369A)

Ref Sequence

ENSEMBL: ENSMUSP00000129522 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000038336] [ENSMUST00000166957] [ENSMUST00000209244]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000038336
AA Change: T2369A

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)

SMART Domains

Protein: ENSMUSP00000036988
Gene: ENSMUSG00000038725
AA Change: T2369A

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
IPT	30	141	9.02e-3	SMART
Pfam:TIG	146	255	1.6e-16	PFAM
IPT	269	362	2.27e-8	SMART
PbH1	398	420	2.98e3	SMART
IPT	1066	1154	5.34e-5	SMART
IPT	1156	1235	1.44e-1	SMART
Pfam:TIG	1240	1322	1.1e-13	PFAM
IPT	1328	1407	7.06e0	SMART
Pfam:TIG	1565	1645	5.1e-11	PFAM
IPT	1657	1743	1.89e-5	SMART
Pfam:TIG	1748	1828	2.1e-10	PFAM
IPT	1829	1910	4.87e-8	SMART
IPT	1914	1997	6.84e-3	SMART
IPT	1998	2085	9.86e-1	SMART
IPT	2089	2176	7.21e-11	SMART
PbH1	2105	2126	1.56e3	SMART
G8	2183	2303	2.37e-59	SMART
PbH1	2484	2506	9.48e3	SMART
PbH1	2507	2529	8.45e2	SMART
PbH1	2565	2587	4.11e3	SMART
PbH1	2664	2686	3.5e3	SMART
PbH1	2732	2755	2.7e3	SMART
Blast:G8	2949	2979	1e-5	BLAST
low complexity region	3014	3025	N/A	INTRINSIC
G8	3035	3173	6.5e-57	SMART
PbH1	3292	3314	1.96e3	SMART
PbH1	3354	3376	3.79e1	SMART
PbH1	3415	3437	4.87e2	SMART
PbH1	3470	3492	8.34e3	SMART
PbH1	3493	3514	5.86e3	SMART
low complexity region	3563	3574	N/A	INTRINSIC
low complexity region	4076	4103	N/A	INTRINSIC
low complexity region	4184	4212	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000166957
AA Change: T2369A

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000129522
Gene: ENSMUSG00000038725
AA Change: T2369A

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
IPT	30	141	9.02e-3	SMART
Pfam:TIG	146	255	9.4e-18	PFAM
IPT	269	362	2.27e-8	SMART
PbH1	398	420	2.98e3	SMART
IPT	1066	1154	5.34e-5	SMART
IPT	1156	1235	1.44e-1	SMART
Pfam:TIG	1240	1323	3e-13	PFAM
IPT	1328	1407	7.06e0	SMART
Pfam:TIG	1565	1645	3.7e-11	PFAM
IPT	1657	1743	1.89e-5	SMART
Pfam:TIG	1748	1828	9.7e-12	PFAM
IPT	1829	1910	4.87e-8	SMART
IPT	1914	1997	6.84e-3	SMART
IPT	1998	2085	9.86e-1	SMART
IPT	2089	2176	7.21e-11	SMART
PbH1	2105	2126	1.56e3	SMART
G8	2183	2303	2.37e-59	SMART
PbH1	2484	2506	9.48e3	SMART
PbH1	2507	2529	8.45e2	SMART
PbH1	2565	2587	4.11e3	SMART
PbH1	2664	2686	3.5e3	SMART
PbH1	2732	2755	2.7e3	SMART
Blast:G8	2949	2979	1e-5	BLAST
low complexity region	3014	3025	N/A	INTRINSIC
G8	3035	3173	6.5e-57	SMART
PbH1	3292	3314	1.96e3	SMART
PbH1	3354	3376	3.79e1	SMART
PbH1	3415	3437	4.87e2	SMART
PbH1	3470	3492	8.34e3	SMART
PbH1	3493	3514	5.86e3	SMART
low complexity region	3563	3574	N/A	INTRINSIC
low complexity region	4076	4103	N/A	INTRINSIC
low complexity region	4184	4212	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000209244
AA Change: T2369A

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)

Meta Mutation Damage Score

0.0666

Coding Region Coverage

1x: 98.7%
3x: 97.5%
10x: 92.9%
20x: 80.7%

Validation Efficiency

97% (130/134)

Allele List at MGI

Other mutations in this stock

Total: 112 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310030G06Rik	G	A	9: 50,740,673	T85M	probably damaging	Het
5430419D17Rik	T	A	7: 131,244,831	Y777*	probably null	Het
Actn1	A	G	12: 80,172,957		probably benign	Het
Afap1l1	A	T	18: 61,737,499	S603T	probably damaging	Het
Ahcy	T	C	2: 155,068,931	Y39C	probably benign	Het
Ankmy2	T	C	12: 36,186,942		probably null	Het
Anxa13	A	T	15: 58,348,807		noncoding transcript	Het
Aoc1	T	C	6: 48,905,786	S221P	possibly damaging	Het
Arhgef10	C	A	8: 14,991,211	A770D	possibly damaging	Het
Arhgef19	A	G	4: 141,254,754	D707G	probably benign	Het
Arhgef3	G	A	14: 27,401,735	R444H	probably damaging	Het
Asphd1	T	C	7: 126,949,099	I11V	probably benign	Het
Atp2b1	A	G	10: 98,994,675	M333V	probably benign	Het
BC051665	T	C	13: 60,785,027	Y40C	probably damaging	Het
Ccdc87	T	A	19: 4,840,313	S278T	probably benign	Het
Chaf1b	G	A	16: 93,901,230	G463D	possibly damaging	Het
Chrna4	T	C	2: 181,029,307	T219A	possibly damaging	Het
Clcnkb	T	G	4: 141,407,095	T584P	possibly damaging	Het
Clptm1l	T	C	13: 73,607,747	S161P	probably benign	Het
Cmya5	T	C	13: 93,094,269	E1437G	possibly damaging	Het
Col13a1	A	T	10: 61,866,426		probably null	Het
Col3a1	T	C	1: 45,345,968	S82P	possibly damaging	Het
Cpeb3	A	T	19: 37,139,082	M383K	probably benign	Het
Cr2	T	A	1: 195,163,314	H111L	probably damaging	Het
Cttnbp2	T	C	6: 18,375,975	S1522G	possibly damaging	Het
Cul3	T	C	1: 80,282,789	D281G	possibly damaging	Het
Cyp2c70	T	G	19: 40,183,982	K72T	probably benign	Het
Cyp39a1	A	T	17: 43,680,129	I110F	probably damaging	Het
Cyp46a1	T	A	12: 108,351,939	M203K	probably null	Het
Cyp8b1	A	T	9: 121,914,958	V436D	possibly damaging	Het
Ddx17	T	C	15: 79,538,565	D324G	probably damaging	Het
Dopey2	A	G	16: 93,770,153	N1274S	probably damaging	Het
Dscaml1	G	A	9: 45,721,333	V1166I	probably benign	Het
Dsp	T	C	13: 38,195,738	V1554A	probably damaging	Het
Dusp27	C	T	1: 166,099,455	V863M	possibly damaging	Het
Efr3a	T	A	15: 65,854,792		probably null	Het
Egfem1	A	T	3: 29,648,271	N223I	probably benign	Het
Egr2	T	C	10: 67,539,975	S147P	probably damaging	Het
Elmo3	A	G	8: 105,308,301	T408A	probably benign	Het
Flnb	A	G	14: 7,883,908	D378G	probably damaging	Het
Foxj2	T	A	6: 122,833,261	M193K	probably benign	Het
Gm6327	A	G	16: 12,760,156		noncoding transcript	Het
Gm7694	T	C	1: 170,302,766	H21R	probably benign	Het
Gpr107	A	G	2: 31,167,025	D43G	probably damaging	Het
Grid2	T	A	6: 64,429,694	Y679*	probably null	Het
Grin2c	G	A	11: 115,256,074	P432S	possibly damaging	Het
H2-M10.1	A	G	17: 36,325,733	F60L	possibly damaging	Het
Hectd4	A	G	5: 121,301,878	D1147G	possibly damaging	Het
Idua	G	T	5: 108,680,589	A223S	probably benign	Het
Ifi206	T	C	1: 173,486,853	Q7R	probably benign	Het
Itgad	T	A	7: 128,203,234	V986E	probably damaging	Het
Itsn2	G	A	12: 4,650,044	R670H	probably benign	Het
Kdm4a	T	C	4: 118,138,949	E961G	possibly damaging	Het
Klra5	T	A	6: 129,906,622	I91L	probably damaging	Het
Kntc1	A	G	5: 123,772,113	T525A	probably damaging	Het
Lct	A	G	1: 128,294,195	F1536L	probably benign	Het
Lmod1	T	A	1: 135,363,933	D175E	probably benign	Het
Lonrf1	A	C	8: 36,233,972	D361E	probably benign	Het
Lrrc19	T	C	4: 94,638,429	Y297C	probably damaging	Het
Mast4	T	C	13: 102,736,923	E1787G	possibly damaging	Het
Mpp2	G	A	11: 102,060,548	A452V	probably benign	Het
Msh2	T	C	17: 87,718,652	V686A	possibly damaging	Het
Mthfd1	C	T	12: 76,270,419	Q15*	probably null	Het
Mtnr1b	A	T	9: 15,863,142	I207N	probably damaging	Het
Nid2	A	G	14: 19,805,412	T1207A	probably benign	Het
Nin	A	T	12: 70,038,750	V1569D	probably damaging	Het
Nov	T	A	15: 54,749,252	M219K	possibly damaging	Het
Nrcam	T	A	12: 44,537,364		probably benign	Het
Nsd1	T	A	13: 55,246,969	H897Q	probably damaging	Het
Olfr102	A	T	17: 37,313,480	N301K	probably benign	Het
Olfr1364	T	A	13: 21,574,310	I49F	possibly damaging	Het
Olfr77	G	T	9: 19,920,912	K234N	probably benign	Het
Olfr979	A	G	9: 40,001,194	F11S	probably benign	Het
Paip1	T	C	13: 119,451,784		probably benign	Het
Pcnx3	G	A	19: 5,685,347	R484*	probably null	Het
Pdxk	A	G	10: 78,447,980	Y127H	probably damaging	Het
Phf20	T	A	2: 156,287,834	V442E	probably benign	Het
Phlpp1	G	A	1: 106,392,789	D1505N	probably damaging	Het
Pkhd1	T	C	1: 20,347,440	T2496A	probably benign	Het
Plod2	T	A	9: 92,603,067		probably benign	Het
Pnpla7	T	A	2: 25,015,251	M617K	possibly damaging	Het
Ppp1r16a	C	T	15: 76,693,669	Q328*	probably null	Het
Prkch	T	A	12: 73,649,357		probably null	Het
Prr12	G	A	7: 45,028,800	H1974Y	unknown	Het
Prr16	A	G	18: 51,302,970	I174V	probably benign	Het
Prss45	A	T	9: 110,838,429	T39S	probably benign	Het
Pum1	T	A	4: 130,718,204	D161E	probably damaging	Het
Rad51ap2	A	G	12: 11,457,112	D345G	probably damaging	Het
Ralgapb	A	G	2: 158,446,199		probably benign	Het
Rasgrp3	A	G	17: 75,500,734	H262R	possibly damaging	Het
Rnf213	T	A	11: 119,436,611	I1809N	probably damaging	Het
Ryr1	A	G	7: 29,062,191	L3177P	probably damaging	Het
Scyl2	C	A	10: 89,650,956	R230L	probably damaging	Het
Sfxn2	T	C	19: 46,582,476		probably benign	Het
Slc18b1	T	C	10: 23,798,741		probably benign	Het
Spata31d1d	T	C	13: 59,728,191	H510R	probably benign	Het
Stab1	A	T	14: 31,150,823	N1109K	probably damaging	Het
Sult3a2	A	G	10: 33,781,977	S47P	probably damaging	Het
Tenm3	T	C	8: 48,228,993	N2518S	possibly damaging	Het
Tex21	G	T	12: 76,206,891	P416Q	probably benign	Het
Tex38	T	C	4: 115,780,306	N100S	probably benign	Het
Thsd4	A	C	9: 60,394,553		probably benign	Het
Ticrr	T	C	7: 79,681,824	V723A	probably damaging	Het
Tmprss15	A	G	16: 79,090,829	V30A	probably benign	Het
Uba3	A	G	6: 97,185,337		probably benign	Het
Ubr1	T	C	2: 120,935,319		probably benign	Het
Uchl4	A	T	9: 64,235,731	I165L	probably benign	Het
Vmn2r112	A	T	17: 22,603,144	T268S	possibly damaging	Het
Wfdc3	T	C	2: 164,744,194		probably benign	Het
Zfp282	T	A	6: 47,892,867	L282Q	probably damaging	Het
Zfp422	A	T	6: 116,626,784	C85S	probably damaging	Het
Zfp790	A	T	7: 29,828,139	Q83L	probably benign	Het

Other mutations in Pkhd1l1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00233:Pkhd1l1	APN	15	44477586	missense	probably damaging	1.00
IGL00235:Pkhd1l1	APN	15	44556019	missense	probably damaging	1.00
IGL00264:Pkhd1l1	APN	15	44491029	missense	possibly damaging	0.67
IGL00537:Pkhd1l1	APN	15	44591992	missense	possibly damaging	0.88
IGL00537:Pkhd1l1	APN	15	44500047	missense	probably benign	0.42
IGL00580:Pkhd1l1	APN	15	44586474	missense	probably damaging	0.98
IGL01085:Pkhd1l1	APN	15	44562752	splice site	probably null
IGL01089:Pkhd1l1	APN	15	44483869	splice site	probably benign
IGL01094:Pkhd1l1	APN	15	44546929	missense	probably benign	0.09
IGL01120:Pkhd1l1	APN	15	44505312	critical splice donor site	probably null
IGL01307:Pkhd1l1	APN	15	44530029	missense	possibly damaging	0.82
IGL01362:Pkhd1l1	APN	15	44532982	missense	probably benign	0.00
IGL01403:Pkhd1l1	APN	15	44483833	nonsense	probably null
IGL01546:Pkhd1l1	APN	15	44566316	missense	probably damaging	1.00
IGL01596:Pkhd1l1	APN	15	44529410	missense	possibly damaging	0.50
IGL01696:Pkhd1l1	APN	15	44529351	missense	possibly damaging	0.79
IGL01844:Pkhd1l1	APN	15	44499400	splice site	probably benign
IGL02007:Pkhd1l1	APN	15	44533733	splice site	probably benign
IGL02041:Pkhd1l1	APN	15	44493056	splice site	probably null
IGL02171:Pkhd1l1	APN	15	44516146	missense	possibly damaging	0.80
IGL02206:Pkhd1l1	APN	15	44512849	missense	probably benign	0.08
IGL02266:Pkhd1l1	APN	15	44573614	missense	probably damaging	1.00
IGL02487:Pkhd1l1	APN	15	44459426	missense	possibly damaging	0.65
IGL02488:Pkhd1l1	APN	15	44558597	missense	probably benign
IGL02522:Pkhd1l1	APN	15	44555902	missense	possibly damaging	0.71
IGL02554:Pkhd1l1	APN	15	44578500	missense	probably damaging	1.00
IGL02566:Pkhd1l1	APN	15	44526054	splice site	probably null
IGL02602:Pkhd1l1	APN	15	44557931	missense	probably damaging	1.00
IGL02606:Pkhd1l1	APN	15	44589456	missense	probably benign	0.00
IGL02623:Pkhd1l1	APN	15	44584873	missense	probably damaging	1.00
IGL02634:Pkhd1l1	APN	15	44539667	missense	probably damaging	1.00
IGL02637:Pkhd1l1	APN	15	44564324	missense	probably damaging	1.00
IGL02651:Pkhd1l1	APN	15	44483814	missense	probably damaging	1.00
IGL02679:Pkhd1l1	APN	15	44530045	critical splice donor site	probably null
IGL02684:Pkhd1l1	APN	15	44516209	critical splice donor site	probably null
IGL02739:Pkhd1l1	APN	15	44540950	missense	probably benign	0.11
IGL02831:Pkhd1l1	APN	15	44501493	missense	probably benign	0.18
IGL02839:Pkhd1l1	APN	15	44529543	missense	probably damaging	0.98
IGL02944:Pkhd1l1	APN	15	44501531	missense	probably damaging	1.00
IGL02957:Pkhd1l1	APN	15	44512908	missense	probably damaging	1.00
IGL03001:Pkhd1l1	APN	15	44558004	missense	probably damaging	1.00
IGL03030:Pkhd1l1	APN	15	44591976	missense	probably benign	0.00
IGL03030:Pkhd1l1	APN	15	44596902	missense	probably benign	0.41
IGL03132:Pkhd1l1	APN	15	44574617	missense	probably damaging	1.00
IGL03194:Pkhd1l1	APN	15	44518135	missense	probably damaging	1.00
IGL03219:Pkhd1l1	APN	15	44596895	missense	possibly damaging	0.62
IGL03236:Pkhd1l1	APN	15	44581826	missense	probably damaging	1.00
IGL03266:Pkhd1l1	APN	15	44538952	missense	probably damaging	1.00
IGL03276:Pkhd1l1	APN	15	44594584	missense	possibly damaging	0.77
IGL03284:Pkhd1l1	APN	15	44547518	splice site	probably benign
IGL03377:Pkhd1l1	APN	15	44484351	splice site	probably null
R0310_Pkhd1l1_251	UTSW	15	44522738	splice site	probably benign
R0344_Pkhd1l1_462	UTSW	15	44597011	missense	probably benign	0.15
R1737_Pkhd1l1_815	UTSW	15	44547509	critical splice donor site	probably null
R5049_Pkhd1l1_556	UTSW	15	44457616	missense	probably benign	0.00
K7371:Pkhd1l1	UTSW	15	44537442	missense	possibly damaging	0.67
K7371:Pkhd1l1	UTSW	15	44500067	missense	possibly damaging	0.94
N/A - 287:Pkhd1l1	UTSW	15	44582258	missense	probably damaging	0.98
P4717OSA:Pkhd1l1	UTSW	15	44523499	missense	probably benign	0.17
P4717OSA:Pkhd1l1	UTSW	15	44528247	missense	probably damaging	1.00
R0007:Pkhd1l1	UTSW	15	44574398	splice site	probably benign
R0020:Pkhd1l1	UTSW	15	44556872	missense	probably damaging	1.00
R0034:Pkhd1l1	UTSW	15	44504009	missense	probably benign	0.00
R0040:Pkhd1l1	UTSW	15	44573625	missense	probably damaging	1.00
R0050:Pkhd1l1	UTSW	15	44573807	missense	possibly damaging	0.79
R0050:Pkhd1l1	UTSW	15	44573807	missense	possibly damaging	0.79
R0063:Pkhd1l1	UTSW	15	44529237	missense	probably damaging	1.00
R0063:Pkhd1l1	UTSW	15	44529237	missense	probably damaging	1.00
R0086:Pkhd1l1	UTSW	15	44556008	missense	possibly damaging	0.94
R0103:Pkhd1l1	UTSW	15	44597141	missense	probably benign
R0103:Pkhd1l1	UTSW	15	44597141	missense	probably benign
R0127:Pkhd1l1	UTSW	15	44554605	missense	probably damaging	0.99
R0226:Pkhd1l1	UTSW	15	44526784	missense	possibly damaging	0.65
R0268:Pkhd1l1	UTSW	15	44597011	missense	probably benign	0.15
R0294:Pkhd1l1	UTSW	15	44560435	missense	probably benign	0.05
R0310:Pkhd1l1	UTSW	15	44522738	splice site	probably benign
R0344:Pkhd1l1	UTSW	15	44597011	missense	probably benign	0.15
R0449:Pkhd1l1	UTSW	15	44501519	missense	probably damaging	1.00
R0492:Pkhd1l1	UTSW	15	44519690	missense	probably benign	0.03
R0505:Pkhd1l1	UTSW	15	44589418	missense	probably damaging	1.00
R0529:Pkhd1l1	UTSW	15	44526754	missense	possibly damaging	0.62
R0543:Pkhd1l1	UTSW	15	44523491	critical splice acceptor site	probably null
R0552:Pkhd1l1	UTSW	15	44489546	missense	probably damaging	0.98
R0558:Pkhd1l1	UTSW	15	44484424	missense	probably damaging	0.97
R0609:Pkhd1l1	UTSW	15	44467424	missense	possibly damaging	0.48
R0619:Pkhd1l1	UTSW	15	44483838	missense	probably damaging	1.00
R0727:Pkhd1l1	UTSW	15	44535788	missense	possibly damaging	0.80
R0787:Pkhd1l1	UTSW	15	44529264	missense	probably damaging	1.00
R0846:Pkhd1l1	UTSW	15	44495597	missense	probably damaging	1.00
R0909:Pkhd1l1	UTSW	15	44538883	splice site	probably null
R0942:Pkhd1l1	UTSW	15	44532959	missense	probably benign	0.01
R1056:Pkhd1l1	UTSW	15	44591964	missense	probably damaging	1.00
R1147:Pkhd1l1	UTSW	15	44537441	missense	probably null	0.15
R1147:Pkhd1l1	UTSW	15	44537441	missense	probably null	0.15
R1187:Pkhd1l1	UTSW	15	44498051	missense	possibly damaging	0.65
R1328:Pkhd1l1	UTSW	15	44497996	missense	probably benign	0.01
R1331:Pkhd1l1	UTSW	15	44505547	missense	probably damaging	1.00
R1331:Pkhd1l1	UTSW	15	44589597	missense	probably damaging	1.00
R1332:Pkhd1l1	UTSW	15	44505547	missense	probably damaging	1.00
R1335:Pkhd1l1	UTSW	15	44505547	missense	probably damaging	1.00
R1338:Pkhd1l1	UTSW	15	44526724	missense	probably damaging	1.00
R1440:Pkhd1l1	UTSW	15	44540988	splice site	probably benign
R1445:Pkhd1l1	UTSW	15	44505644	missense	probably benign	0.32
R1458:Pkhd1l1	UTSW	15	44516115	missense	probably benign	0.01
R1469:Pkhd1l1	UTSW	15	44536886	missense	probably benign	0.45
R1469:Pkhd1l1	UTSW	15	44536886	missense	probably benign	0.45
R1500:Pkhd1l1	UTSW	15	44545494	missense	probably damaging	1.00
R1528:Pkhd1l1	UTSW	15	44526724	missense	probably damaging	1.00
R1542:Pkhd1l1	UTSW	15	44528191	missense	probably benign	0.44
R1568:Pkhd1l1	UTSW	15	44545501	splice site	probably null
R1571:Pkhd1l1	UTSW	15	44526841	missense	probably benign
R1604:Pkhd1l1	UTSW	15	44467367	nonsense	probably null
R1638:Pkhd1l1	UTSW	15	44597117	missense	probably benign	0.06
R1639:Pkhd1l1	UTSW	15	44540955	missense	probably damaging	0.99
R1737:Pkhd1l1	UTSW	15	44547509	critical splice donor site	probably null
R1816:Pkhd1l1	UTSW	15	44528239	missense	possibly damaging	0.91
R1826:Pkhd1l1	UTSW	15	44503345	missense	possibly damaging	0.75
R1880:Pkhd1l1	UTSW	15	44525242	missense	probably benign	0.13
R1930:Pkhd1l1	UTSW	15	44503337	missense	possibly damaging	0.69
R1933:Pkhd1l1	UTSW	15	44540884	missense	possibly damaging	0.48
R1938:Pkhd1l1	UTSW	15	44500038	missense	probably benign
R1975:Pkhd1l1	UTSW	15	44529713	missense	probably damaging	1.00
R1999:Pkhd1l1	UTSW	15	44499982	splice site	probably null
R2037:Pkhd1l1	UTSW	15	44568221	splice site	probably null
R2045:Pkhd1l1	UTSW	15	44479654	missense	probably damaging	1.00
R2049:Pkhd1l1	UTSW	15	44547513	splice site	probably benign
R2049:Pkhd1l1	UTSW	15	44581741	missense	probably damaging	1.00
R2063:Pkhd1l1	UTSW	15	44550752	missense	possibly damaging	0.69
R2072:Pkhd1l1	UTSW	15	44558639	missense	probably damaging	1.00
R2073:Pkhd1l1	UTSW	15	44558639	missense	probably damaging	1.00
R2075:Pkhd1l1	UTSW	15	44558639	missense	probably damaging	1.00
R2078:Pkhd1l1	UTSW	15	44527767	missense	probably benign	0.08
R2116:Pkhd1l1	UTSW	15	44569482	missense	probably damaging	0.97
R2133:Pkhd1l1	UTSW	15	44516185	missense	possibly damaging	0.91
R2138:Pkhd1l1	UTSW	15	44501457	missense	probably damaging	1.00
R2139:Pkhd1l1	UTSW	15	44529818	missense	possibly damaging	0.46
R2145:Pkhd1l1	UTSW	15	44512877	splice site	probably null
R2150:Pkhd1l1	UTSW	15	44499982	splice site	probably null
R2177:Pkhd1l1	UTSW	15	44459395	missense	probably benign
R2184:Pkhd1l1	UTSW	15	44499296	missense	possibly damaging	0.89
R2216:Pkhd1l1	UTSW	15	44573895	missense	probably damaging	1.00
R2226:Pkhd1l1	UTSW	15	44512792	missense	possibly damaging	0.79
R2227:Pkhd1l1	UTSW	15	44512792	missense	possibly damaging	0.79
R2243:Pkhd1l1	UTSW	15	44546927	missense	probably damaging	1.00
R2290:Pkhd1l1	UTSW	15	44528250	missense	probably benign	0.03
R2294:Pkhd1l1	UTSW	15	44479607	missense	probably damaging	0.99
R2346:Pkhd1l1	UTSW	15	44560506	missense	possibly damaging	0.82
R2356:Pkhd1l1	UTSW	15	44533019	missense	probably benign	0.00
R2386:Pkhd1l1	UTSW	15	44528178	missense	probably benign	0.00
R2404:Pkhd1l1	UTSW	15	44550820	missense	probably damaging	1.00
R2504:Pkhd1l1	UTSW	15	44485428	missense	probably damaging	0.97
R2679:Pkhd1l1	UTSW	15	44545386	missense	probably damaging	0.99
R2860:Pkhd1l1	UTSW	15	44540871	missense	probably damaging	1.00
R2861:Pkhd1l1	UTSW	15	44540871	missense	probably damaging	1.00
R2862:Pkhd1l1	UTSW	15	44540871	missense	probably damaging	1.00
R2972:Pkhd1l1	UTSW	15	44547248	missense	possibly damaging	0.65
R3016:Pkhd1l1	UTSW	15	44545370	missense	probably benign	0.02
R3162:Pkhd1l1	UTSW	15	44505528	missense	probably damaging	1.00
R3162:Pkhd1l1	UTSW	15	44505528	missense	probably damaging	1.00
R3416:Pkhd1l1	UTSW	15	44547364	missense	probably damaging	1.00
R3623:Pkhd1l1	UTSW	15	44526869	missense	probably damaging	1.00
R3687:Pkhd1l1	UTSW	15	44546587	missense	probably benign	0.17
R3755:Pkhd1l1	UTSW	15	44589406	missense	probably damaging	1.00
R3776:Pkhd1l1	UTSW	15	44514975	critical splice donor site	probably null
R3803:Pkhd1l1	UTSW	15	44493135	missense	probably benign	0.25
R3942:Pkhd1l1	UTSW	15	44592026	critical splice donor site	probably null
R4010:Pkhd1l1	UTSW	15	44529100	missense	possibly damaging	0.80
R4049:Pkhd1l1	UTSW	15	44498557	missense	probably damaging	1.00
R4059:Pkhd1l1	UTSW	15	44550760	missense	probably benign	0.01
R4179:Pkhd1l1	UTSW	15	44523649	missense	probably benign	0.45
R4184:Pkhd1l1	UTSW	15	44591906	missense	probably benign	0.00
R4369:Pkhd1l1	UTSW	15	44505553	missense	probably benign	0.00
R4462:Pkhd1l1	UTSW	15	44581804	missense	probably damaging	1.00
R4551:Pkhd1l1	UTSW	15	44550885	missense	probably damaging	1.00
R4618:Pkhd1l1	UTSW	15	44539682	missense	probably damaging	1.00
R4632:Pkhd1l1	UTSW	15	44484400	missense	probably benign	0.07
R4657:Pkhd1l1	UTSW	15	44547347	missense	probably damaging	1.00
R4716:Pkhd1l1	UTSW	15	44556032	missense	probably damaging	1.00
R4788:Pkhd1l1	UTSW	15	44498021	missense	probably damaging	0.99
R4828:Pkhd1l1	UTSW	15	44529405	missense	possibly damaging	0.55
R4858:Pkhd1l1	UTSW	15	44491101	missense	probably damaging	0.99
R4860:Pkhd1l1	UTSW	15	44537378	missense	possibly damaging	0.77
R4860:Pkhd1l1	UTSW	15	44537378	missense	possibly damaging	0.77
R4951:Pkhd1l1	UTSW	15	44533891	missense	possibly damaging	0.82
R4963:Pkhd1l1	UTSW	15	44504025	missense	probably benign	0.00
R5023:Pkhd1l1	UTSW	15	44528191	missense	probably benign	0.44
R5023:Pkhd1l1	UTSW	15	44582227	missense	probably benign	0.00
R5035:Pkhd1l1	UTSW	15	44568324	missense	probably damaging	1.00
R5049:Pkhd1l1	UTSW	15	44457616	missense	probably benign	0.00
R5065:Pkhd1l1	UTSW	15	44582293	missense	possibly damaging	0.68
R5089:Pkhd1l1	UTSW	15	44591887	missense	probably benign	0.01
R5151:Pkhd1l1	UTSW	15	44505309	missense	probably benign	0.00
R5153:Pkhd1l1	UTSW	15	44505309	missense	probably benign	0.00
R5189:Pkhd1l1	UTSW	15	44547148	missense	probably damaging	1.00
R5204:Pkhd1l1	UTSW	15	44547041	missense	possibly damaging	0.51
R5216:Pkhd1l1	UTSW	15	44495647	nonsense	probably null
R5286:Pkhd1l1	UTSW	15	44514972	nonsense	probably null
R5292:Pkhd1l1	UTSW	15	44529566	missense	probably damaging	1.00
R5293:Pkhd1l1	UTSW	15	44535750	missense	probably benign	0.01
R5298:Pkhd1l1	UTSW	15	44504046	missense	probably benign	0.00
R5327:Pkhd1l1	UTSW	15	44546862	missense	probably damaging	1.00
R5346:Pkhd1l1	UTSW	15	44540967	missense	probably damaging	1.00
R5481:Pkhd1l1	UTSW	15	44558646	missense	probably damaging	1.00
R5645:Pkhd1l1	UTSW	15	44532992	missense	probably benign	0.18
R5718:Pkhd1l1	UTSW	15	44545417	missense	probably damaging	1.00
R5809:Pkhd1l1	UTSW	15	44519707	missense	probably benign	0.03
R5816:Pkhd1l1	UTSW	15	44566322	missense	probably benign	0.01
R5854:Pkhd1l1	UTSW	15	44581790	missense	probably damaging	1.00
R5876:Pkhd1l1	UTSW	15	44578588	missense	possibly damaging	0.51
R5909:Pkhd1l1	UTSW	15	44526763	missense	probably damaging	1.00
R5950:Pkhd1l1	UTSW	15	44532965	missense	probably benign	0.00
R5961:Pkhd1l1	UTSW	15	44459463	missense	probably damaging	1.00
R5972:Pkhd1l1	UTSW	15	44545416	missense	probably damaging	1.00
R5975:Pkhd1l1	UTSW	15	44525988	missense	probably damaging	1.00
R5982:Pkhd1l1	UTSW	15	44489504	splice site	probably null
R6066:Pkhd1l1	UTSW	15	44528129	missense	probably damaging	0.99
R6122:Pkhd1l1	UTSW	15	44557940	missense	probably damaging	1.00
R6248:Pkhd1l1	UTSW	15	44529559	missense	probably benign
R6294:Pkhd1l1	UTSW	15	44570028	missense	probably damaging	1.00
R6301:Pkhd1l1	UTSW	15	44589525	missense	probably damaging	0.99
R6526:Pkhd1l1	UTSW	15	44498089	critical splice donor site	probably null
R6707:Pkhd1l1	UTSW	15	44529143	missense	probably benign
R6736:Pkhd1l1	UTSW	15	44557940	missense	probably damaging	1.00
R6753:Pkhd1l1	UTSW	15	44589663	missense	probably benign	0.45
R6815:Pkhd1l1	UTSW	15	44562655	missense	probably damaging	1.00
R6874:Pkhd1l1	UTSW	15	44589527	missense	probably benign	0.06
R6942:Pkhd1l1	UTSW	15	44522629	missense	probably damaging	1.00
R6970:Pkhd1l1	UTSW	15	44511674	missense	possibly damaging	0.61
R6982:Pkhd1l1	UTSW	15	44566268	missense	probably damaging	0.97
R7103:Pkhd1l1	UTSW	15	44573631	missense	probably benign	0.02
R7116:Pkhd1l1	UTSW	15	44557976	missense	probably benign	0.00
R7135:Pkhd1l1	UTSW	15	44584978	critical splice donor site	probably null
R7143:Pkhd1l1	UTSW	15	44573637	missense	possibly damaging	0.93
R7177:Pkhd1l1	UTSW	15	44467404	missense	probably damaging	1.00
R7194:Pkhd1l1	UTSW	15	44529116	missense	probably damaging	1.00
R7204:Pkhd1l1	UTSW	15	44523553	missense	possibly damaging	0.90
R7215:Pkhd1l1	UTSW	15	44528163	missense	possibly damaging	0.78
R7218:Pkhd1l1	UTSW	15	44522695	missense	possibly damaging	0.49
R7225:Pkhd1l1	UTSW	15	44546941	missense	probably damaging	1.00
R7283:Pkhd1l1	UTSW	15	44503280	missense	probably benign	0.10
R7292:Pkhd1l1	UTSW	15	44498590	missense	probably benign
R7304:Pkhd1l1	UTSW	15	44498482	missense	possibly damaging	0.94
R7349:Pkhd1l1	UTSW	15	44514954	missense	probably damaging	1.00
R7359:Pkhd1l1	UTSW	15	44589486	missense	probably damaging	1.00
R7407:Pkhd1l1	UTSW	15	44595011	missense	possibly damaging	0.75
R7475:Pkhd1l1	UTSW	15	44505185	nonsense	probably null
R7481:Pkhd1l1	UTSW	15	44512911	missense	probably benign
R7554:Pkhd1l1	UTSW	15	44495470	missense	probably damaging	1.00
R7555:Pkhd1l1	UTSW	15	44550761	missense	possibly damaging	0.51
R7562:Pkhd1l1	UTSW	15	44514930	missense	possibly damaging	0.68
R7583:Pkhd1l1	UTSW	15	44568364	critical splice donor site	probably null
R7595:Pkhd1l1	UTSW	15	44495521	missense	probably damaging	1.00
R7749:Pkhd1l1	UTSW	15	44527737	missense	probably benign	0.00
R7754:Pkhd1l1	UTSW	15	44586408	missense	possibly damaging	0.94
R7761:Pkhd1l1	UTSW	15	44529884	missense	probably benign	0.00
R7774:Pkhd1l1	UTSW	15	44540907	missense	probably benign	0.03
R7785:Pkhd1l1	UTSW	15	44543569	missense	probably damaging	1.00
R7790:Pkhd1l1	UTSW	15	44578581	missense	probably damaging	1.00
R7804:Pkhd1l1	UTSW	15	44597138	nonsense	probably null
R7864:Pkhd1l1	UTSW	15	44526053	critical splice donor site	probably null
R7883:Pkhd1l1	UTSW	15	44529126	missense	probably damaging	1.00
R8031:Pkhd1l1	UTSW	15	44512834	missense	probably damaging	1.00
R8128:Pkhd1l1	UTSW	15	44498053	missense	possibly damaging	0.94
R8142:Pkhd1l1	UTSW	15	44514931	missense	probably benign	0.00
R8150:Pkhd1l1	UTSW	15	44546659	missense	possibly damaging	0.68
R8209:Pkhd1l1	UTSW	15	44574407	missense	possibly damaging	0.46
R8212:Pkhd1l1	UTSW	15	44499300	missense	probably benign	0.12
R8226:Pkhd1l1	UTSW	15	44574407	missense	possibly damaging	0.46
R8248:Pkhd1l1	UTSW	15	44543546	missense	probably damaging	0.99
R8299:Pkhd1l1	UTSW	15	44581934	missense	probably benign	0.26
R8425:Pkhd1l1	UTSW	15	44574515	missense	probably benign	0.01
R8485:Pkhd1l1	UTSW	15	44560400	missense	probably damaging	0.98
R8486:Pkhd1l1	UTSW	15	44547416	missense	probably damaging	1.00
R8701:Pkhd1l1	UTSW	15	44574683	missense	probably damaging	1.00
R8709:Pkhd1l1	UTSW	15	44518174	missense	probably benign	0.01
R8777:Pkhd1l1	UTSW	15	44498571	missense	probably damaging	1.00
R8777-TAIL:Pkhd1l1	UTSW	15	44498571	missense	probably damaging	1.00
R8845:Pkhd1l1	UTSW	15	44505254	missense	probably benign	0.30
R8846:Pkhd1l1	UTSW	15	44546962	nonsense	probably null
R8863:Pkhd1l1	UTSW	15	44569986	nonsense	probably null
R8917:Pkhd1l1	UTSW	15	44533007	missense	probably benign	0.04
R8936:Pkhd1l1	UTSW	15	44538916	missense	possibly damaging	0.94
R8962:Pkhd1l1	UTSW	15	44536895	missense	probably damaging	1.00
R8971:Pkhd1l1	UTSW	15	44529519	missense	possibly damaging	0.68
R8973:Pkhd1l1	UTSW	15	44586437	missense	probably damaging	1.00
R8982:Pkhd1l1	UTSW	15	44523673	nonsense	probably null
R8994:Pkhd1l1	UTSW	15	44547103	missense	probably damaging	0.99
R9004:Pkhd1l1	UTSW	15	44543372	missense	probably benign	0.16
R9064:Pkhd1l1	UTSW	15	44562642	missense	possibly damaging	0.93
R9173:Pkhd1l1	UTSW	15	44520756	missense	probably benign	0.09
R9185:Pkhd1l1	UTSW	15	44589623	missense	probably benign	0.01
R9213:Pkhd1l1	UTSW	15	44495478	missense	probably damaging	1.00
R9218:Pkhd1l1	UTSW	15	44520726	missense	possibly damaging	0.90
R9256:Pkhd1l1	UTSW	15	44533894	critical splice donor site	probably null
R9291:Pkhd1l1	UTSW	15	44569976	missense	probably damaging	1.00
R9309:Pkhd1l1	UTSW	15	44536893	missense	probably benign	0.00
R9319:Pkhd1l1	UTSW	15	44529578	missense	possibly damaging	0.46
R9339:Pkhd1l1	UTSW	15	44589553	missense	probably damaging	1.00
R9366:Pkhd1l1	UTSW	15	44546912	missense	probably benign	0.03
R9444:Pkhd1l1	UTSW	15	44554657	missense	probably benign	0.00
R9464:Pkhd1l1	UTSW	15	44479613	missense	probably damaging	1.00
R9525:Pkhd1l1	UTSW	15	44584926	missense	possibly damaging	0.88
R9542:Pkhd1l1	UTSW	15	44546888	missense	probably benign	0.12
R9544:Pkhd1l1	UTSW	15	44546843	missense	probably damaging	1.00
R9608:Pkhd1l1	UTSW	15	44578633	missense	possibly damaging	0.65
R9673:Pkhd1l1	UTSW	15	44523505	missense	probably benign	0.22
R9771:Pkhd1l1	UTSW	15	44495487	missense	probably benign
R9792:Pkhd1l1	UTSW	15	44543587	missense	probably benign	0.00
R9793:Pkhd1l1	UTSW	15	44543587	missense	probably benign	0.00
R9795:Pkhd1l1	UTSW	15	44543587	missense	probably benign	0.00
RF006:Pkhd1l1	UTSW	15	44503238	missense	probably benign	0.03
RF006:Pkhd1l1	UTSW	15	44558507	critical splice acceptor site	probably benign
RF008:Pkhd1l1	UTSW	15	44558505	critical splice acceptor site	probably benign
RF012:Pkhd1l1	UTSW	15	44558505	critical splice acceptor site	probably benign
RF019:Pkhd1l1	UTSW	15	44558507	critical splice acceptor site	probably benign
RF030:Pkhd1l1	UTSW	15	44558502	critical splice acceptor site	probably benign
RF033:Pkhd1l1	UTSW	15	44558506	critical splice acceptor site	probably benign
RF038:Pkhd1l1	UTSW	15	44558503	critical splice acceptor site	probably benign
RF046:Pkhd1l1	UTSW	15	44558495	critical splice acceptor site	probably benign
X0027:Pkhd1l1	UTSW	15	44591966	missense	probably damaging	0.99
Z1177:Pkhd1l1	UTSW	15	44573576	missense	probably damaging	0.97
Z1177:Pkhd1l1	UTSW	15	44578578	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- TGCAGGCTCTGAACAAATCTAGCAC -3'
(R):5'- CAGCCACATGCTGGTTGCTAAAAG -3'

Sequencing Primer
(F):5'- CTAGCACTCCGGTTTGAAATGAG -3'
(R):5'- CATGCTGGTTGCTAAAAGTACCTG -3'

Posted On

2014-04-13