Incidental Mutation 'R1575:Ube2j1'
ID 171077
Institutional Source Beutler Lab
Gene Symbol Ube2j1
Ensembl Gene ENSMUSG00000028277
Gene Name ubiquitin-conjugating enzyme E2J 1
Synonyms 1110030I22Rik, Ubc6p, Ncube, 0710008M05Rik
MMRRC Submission 039613-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R1575 (G1)
Quality Score 225
Status Validated
Chromosome 4
Chromosomal Location 33031416-33052363 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 33045116 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Threonine at position 130 (S130T)
Ref Sequence ENSEMBL: ENSMUSP00000029944 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029944] [ENSMUST00000124992]
AlphaFold Q9JJZ4
Predicted Effect probably benign
Transcript: ENSMUST00000029944
AA Change: S130T

PolyPhen 2 Score 0.232 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000029944
Gene: ENSMUSG00000028277
AA Change: S130T

PDB:2F4W|B 1 78 5e-17 PDB
Blast:UBCc 1 116 4e-72 BLAST
SCOP:d1c4zd_ 2 50 1e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000124992
AA Change: S199T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000118333
Gene: ENSMUSG00000028277
AA Change: S199T

UBCc 13 160 4.49e-30 SMART
low complexity region 249 269 N/A INTRINSIC
transmembrane domain 286 308 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000135924
SMART Domains Protein: ENSMUSP00000115757
Gene: ENSMUSG00000028277

UBCc 1 144 8.08e-23 SMART
low complexity region 193 213 N/A INTRINSIC
transmembrane domain 230 252 N/A INTRINSIC
Meta Mutation Damage Score 0.0604 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.5%
Validation Efficiency 100% (72/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The modification of proteins with ubiquitin is an important cellular mechanism for targeting abnormal or short-lived proteins for degradation. Ubiquitination involves at least three classes of enzymes: ubiquitin-activating enzymes, or E1s, ubiquitin-conjugating enzymes, or E2s, and ubiquitin-protein ligases, or E3s. This gene encodes a member of the E2 ubiquitin-conjugating enzyme family. This enzyme is located in the membrane of the endoplasmic reticulum (ER) and may contribute to quality control ER-associated degradation by the ubiquitin-proteasome system. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit partial postnatal lethality, decreased body size, and male infertility associated with defective spermiogenesis, teratozoospermia, and asthenozoospermia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrl2 T A 3: 148,852,762 T437S probably benign Het
Akna A G 4: 63,379,333 F828S probably benign Het
Alg9 G T 9: 50,775,502 A40S possibly damaging Het
Alox8 T A 11: 69,185,241 H628L possibly damaging Het
Aox3 T C 1: 58,152,554 W422R probably benign Het
Atp13a4 T C 16: 29,409,710 D984G probably benign Het
Bcam T C 7: 19,760,382 E363G possibly damaging Het
Cadps2 C A 6: 23,429,218 V519F probably damaging Het
Calca A G 7: 114,635,161 Y18H probably damaging Het
Cd70 A G 17: 57,146,364 I100T probably damaging Het
Cdk4 T A 10: 127,064,651 H95Q probably damaging Het
Chchd1 T A 14: 20,703,342 N11K probably damaging Het
Cma2 T A 14: 55,972,815 N52K probably damaging Het
Cyp3a16 A G 5: 145,436,457 V500A probably benign Het
Dicer1 A G 12: 104,721,969 probably null Het
Dnajc13 A G 9: 104,156,838 S2206P probably benign Het
Dtl T C 1: 191,561,546 probably null Het
Fam186b T C 15: 99,286,971 T24A probably benign Het
Fbxw21 A G 9: 109,161,916 V25A probably benign Het
Gins1 T C 2: 150,912,838 S45P probably benign Het
Gtpbp2 T A 17: 46,165,943 V349D probably damaging Het
Hyal5 G T 6: 24,876,793 D222Y probably damaging Het
Itgal A G 7: 127,300,888 probably null Het
Klk14 A G 7: 43,693,953 probably null Het
Lama1 T A 17: 67,810,409 L2518Q possibly damaging Het
Lrrc2 G A 9: 110,979,487 G264D probably benign Het
Ltbp4 A G 7: 27,322,820 S893P probably damaging Het
Mast4 G A 13: 102,739,263 P1107L probably damaging Het
Mbd1 T A 18: 74,275,419 probably null Het
Naip2 A T 13: 100,155,021 D1136E probably benign Het
Naip2 G A 13: 100,155,029 probably benign Het
Ncan G A 8: 70,110,198 T470I probably benign Het
Npy1r A T 8: 66,704,161 I78F probably damaging Het
Olfr1491 A T 19: 13,705,525 M233L probably benign Het
Olfr917 G A 9: 38,665,277 T189M probably damaging Het
Palb2 A T 7: 122,110,838 probably null Het
Pax3 T C 1: 78,103,484 T422A probably benign Het
Pebp1 A T 5: 117,286,164 D72E possibly damaging Het
Pnliprp1 A T 19: 58,740,469 T363S probably benign Het
Rbm44 G A 1: 91,156,843 probably null Het
Rbm47 T A 5: 66,025,015 Y425F probably benign Het
Robo3 G T 9: 37,429,661 A83E probably damaging Het
Rrm1 A G 7: 102,456,514 Y279C probably damaging Het
Rslcan18 A T 13: 67,108,057 probably benign Het
Scara5 C A 14: 65,730,865 Q196K probably benign Het
Setd1b C T 5: 123,163,147 probably benign Het
Siah1a A G 8: 86,725,241 F205S probably damaging Het
Smr2 AT ATT 5: 88,108,824 probably null Het
Ssu72 A G 4: 155,731,357 D86G probably benign Het
St7 G T 6: 17,886,111 K357N probably damaging Het
Sv2b G A 7: 75,147,677 T323I probably damaging Het
Syt1 T C 10: 108,504,500 N319S probably benign Het
Tanc1 T A 2: 59,791,651 F371L probably damaging Het
Tcf20 C A 15: 82,855,492 G586V probably benign Het
Tg T C 15: 66,729,685 probably null Het
Tyk2 A T 9: 21,115,462 N620K probably benign Het
Ubr2 G T 17: 46,932,492 P1696H probably damaging Het
Ubr5 A T 15: 38,040,841 D266E probably damaging Het
Vipr2 A G 12: 116,144,272 T426A probably benign Het
Vmn2r104 A T 17: 20,042,215 W218R probably damaging Het
Vmn2r83 T A 10: 79,479,122 N401K probably damaging Het
Vwf A G 6: 125,655,251 E82G unknown Het
Vwf T A 6: 125,663,571 Y2323* probably null Het
Wdr76 T G 2: 121,528,921 V329G probably damaging Het
Zan A G 5: 137,461,952 C1226R unknown Het
Zbtb16 G T 9: 48,832,272 Q247K probably damaging Het
Zfp541 T C 7: 16,078,715 V431A possibly damaging Het
Other mutations in Ube2j1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01539:Ube2j1 APN 4 33043993 splice site probably benign
IGL01800:Ube2j1 APN 4 33045115 missense probably benign 0.00
IGL02707:Ube2j1 APN 4 33038206 missense possibly damaging 0.95
IGL03368:Ube2j1 APN 4 33038317 missense probably damaging 1.00
R0314:Ube2j1 UTSW 4 33043991 splice site probably benign
R1714:Ube2j1 UTSW 4 33049886 missense probably damaging 1.00
R2044:Ube2j1 UTSW 4 33049696 missense probably benign 0.16
R2267:Ube2j1 UTSW 4 33049943 missense possibly damaging 0.51
R2850:Ube2j1 UTSW 4 33049696 missense probably benign 0.16
R3737:Ube2j1 UTSW 4 33036723 missense probably benign 0.06
R3738:Ube2j1 UTSW 4 33036723 missense probably benign 0.06
R4354:Ube2j1 UTSW 4 33049682 missense probably benign 0.05
R5527:Ube2j1 UTSW 4 33045164 missense probably benign 0.00
R5554:Ube2j1 UTSW 4 33040745 missense probably damaging 1.00
R6663:Ube2j1 UTSW 4 33045198 missense probably damaging 0.99
R8122:Ube2j1 UTSW 4 33045145 missense probably benign 0.00
R9158:Ube2j1 UTSW 4 33036711 missense probably benign 0.05
R9168:Ube2j1 UTSW 4 33045111 missense probably benign
R9255:Ube2j1 UTSW 4 33036759 missense probably benign 0.09
R9503:Ube2j1 UTSW 4 33049781 nonsense probably null
R9542:Ube2j1 UTSW 4 33040793 nonsense probably null
X0024:Ube2j1 UTSW 4 33049928 missense probably damaging 1.00
Predicted Primers PCR Primer

Sequencing Primer
(R):5'- gtgaagtgtgatgtgtgtgtag -3'
Posted On 2014-04-13