Incidental Mutation 'R1575:Akna'
ID171078
Institutional Source Beutler Lab
Gene Symbol Akna
Ensembl Gene ENSMUSG00000039158
Gene NameAT-hook transcription factor
Synonyms
MMRRC Submission 039613-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.126) question?
Stock #R1575 (G1)
Quality Score119
Status Validated
Chromosome4
Chromosomal Location63367125-63403354 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 63379333 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 828 (F828S)
Ref Sequence ENSEMBL: ENSMUSP00000041614 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035724]
Predicted Effect probably benign
Transcript: ENSMUST00000035724
AA Change: F828S

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000041614
Gene: ENSMUSG00000039158
AA Change: F828S

DomainStartEndE-ValueType
low complexity region 140 153 N/A INTRINSIC
coiled coil region 423 458 N/A INTRINSIC
Pfam:AKNA 584 681 4.6e-37 PFAM
low complexity region 760 774 N/A INTRINSIC
low complexity region 1015 1029 N/A INTRINSIC
coiled coil region 1044 1066 N/A INTRINSIC
low complexity region 1296 1317 N/A INTRINSIC
low complexity region 1319 1343 N/A INTRINSIC
coiled coil region 1353 1386 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140586
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144095
Meta Mutation Damage Score 0.0604 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.5%
Validation Efficiency 100% (72/72)
MGI Phenotype PHENOTYPE: Mice homozygous for a hypomorphic or a knock-out allele exhibit partial postnatal lethality, pathogen-induced acute neutrophil responses leading to systemic inflammation and alveolar destruction, and increased susceptibility to fungal infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrl2 T A 3: 148,852,762 T437S probably benign Het
Alg9 G T 9: 50,775,502 A40S possibly damaging Het
Alox8 T A 11: 69,185,241 H628L possibly damaging Het
Aox3 T C 1: 58,152,554 W422R probably benign Het
Atp13a4 T C 16: 29,409,710 D984G probably benign Het
Bcam T C 7: 19,760,382 E363G possibly damaging Het
Cadps2 C A 6: 23,429,218 V519F probably damaging Het
Calca A G 7: 114,635,161 Y18H probably damaging Het
Cd70 A G 17: 57,146,364 I100T probably damaging Het
Cdk4 T A 10: 127,064,651 H95Q probably damaging Het
Chchd1 T A 14: 20,703,342 N11K probably damaging Het
Cma2 T A 14: 55,972,815 N52K probably damaging Het
Cyp3a16 A G 5: 145,436,457 V500A probably benign Het
Dicer1 A G 12: 104,721,969 probably null Het
Dnajc13 A G 9: 104,156,838 S2206P probably benign Het
Dtl T C 1: 191,561,546 probably null Het
Fam186b T C 15: 99,286,971 T24A probably benign Het
Fbxw21 A G 9: 109,161,916 V25A probably benign Het
Gins1 T C 2: 150,912,838 S45P probably benign Het
Gtpbp2 T A 17: 46,165,943 V349D probably damaging Het
Hyal5 G T 6: 24,876,793 D222Y probably damaging Het
Itgal A G 7: 127,300,888 probably null Het
Klk14 A G 7: 43,693,953 probably null Het
Lama1 T A 17: 67,810,409 L2518Q possibly damaging Het
Lrrc2 G A 9: 110,979,487 G264D probably benign Het
Ltbp4 A G 7: 27,322,820 S893P probably damaging Het
Mast4 G A 13: 102,739,263 P1107L probably damaging Het
Mbd1 T A 18: 74,275,419 probably null Het
Naip2 A T 13: 100,155,021 D1136E probably benign Het
Naip2 G A 13: 100,155,029 probably benign Het
Ncan G A 8: 70,110,198 T470I probably benign Het
Npy1r A T 8: 66,704,161 I78F probably damaging Het
Olfr1491 A T 19: 13,705,525 M233L probably benign Het
Olfr917 G A 9: 38,665,277 T189M probably damaging Het
Palb2 A T 7: 122,110,838 probably null Het
Pax3 T C 1: 78,103,484 T422A probably benign Het
Pebp1 A T 5: 117,286,164 D72E possibly damaging Het
Pnliprp1 A T 19: 58,740,469 T363S probably benign Het
Rbm44 G A 1: 91,156,843 probably null Het
Rbm47 T A 5: 66,025,015 Y425F probably benign Het
Robo3 G T 9: 37,429,661 A83E probably damaging Het
Rrm1 A G 7: 102,456,514 Y279C probably damaging Het
Rslcan18 A T 13: 67,108,057 probably benign Het
Scara5 C A 14: 65,730,865 Q196K probably benign Het
Setd1b C T 5: 123,163,147 probably benign Het
Siah1a A G 8: 86,725,241 F205S probably damaging Het
Smr2 AT ATT 5: 88,108,824 probably null Het
Ssu72 A G 4: 155,731,357 D86G probably benign Het
St7 G T 6: 17,886,111 K357N probably damaging Het
Sv2b G A 7: 75,147,677 T323I probably damaging Het
Syt1 T C 10: 108,504,500 N319S probably benign Het
Tanc1 T A 2: 59,791,651 F371L probably damaging Het
Tcf20 C A 15: 82,855,492 G586V probably benign Het
Tg T C 15: 66,729,685 probably null Het
Tyk2 A T 9: 21,115,462 N620K probably benign Het
Ube2j1 T A 4: 33,045,116 S130T probably benign Het
Ubr2 G T 17: 46,932,492 P1696H probably damaging Het
Ubr5 A T 15: 38,040,841 D266E probably damaging Het
Vipr2 A G 12: 116,144,272 T426A probably benign Het
Vmn2r104 A T 17: 20,042,215 W218R probably damaging Het
Vmn2r83 T A 10: 79,479,122 N401K probably damaging Het
Vwf A G 6: 125,655,251 E82G unknown Het
Vwf T A 6: 125,663,571 Y2323* probably null Het
Wdr76 T G 2: 121,528,921 V329G probably damaging Het
Zan A G 5: 137,461,952 C1226R unknown Het
Zbtb16 G T 9: 48,832,272 Q247K probably damaging Het
Zfp541 T C 7: 16,078,715 V431A possibly damaging Het
Other mutations in Akna
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00533:Akna APN 4 63397873 critical splice donor site probably null
IGL00590:Akna APN 4 63371878 missense probably benign 0.00
IGL01567:Akna APN 4 63381850 missense probably benign
IGL01667:Akna APN 4 63379159 missense probably benign 0.34
IGL01820:Akna APN 4 63386258 missense probably benign 0.30
IGL01956:Akna APN 4 63379290 missense probably benign 0.04
IGL02148:Akna APN 4 63382479 splice site probably benign
IGL02502:Akna APN 4 63368203 missense probably benign 0.28
IGL02674:Akna APN 4 63370944 nonsense probably null
IGL02792:Akna APN 4 63377706 missense possibly damaging 0.73
IGL02956:Akna APN 4 63386279 missense probably benign 0.05
R0035:Akna UTSW 4 63382445 missense probably benign 0.16
R0049:Akna UTSW 4 63394635 missense probably damaging 0.97
R0133:Akna UTSW 4 63379361 nonsense probably null
R0396:Akna UTSW 4 63392126 splice site probably benign
R0422:Akna UTSW 4 63392154 missense probably damaging 1.00
R0578:Akna UTSW 4 63370910 missense probably benign
R0784:Akna UTSW 4 63376888 missense probably benign
R1264:Akna UTSW 4 63381725 splice site probably null
R1539:Akna UTSW 4 63379310 missense probably benign 0.00
R1646:Akna UTSW 4 63383892 missense probably benign
R2115:Akna UTSW 4 63395160 missense probably benign 0.01
R2121:Akna UTSW 4 63376900 missense probably benign 0.08
R2324:Akna UTSW 4 63371802 missense possibly damaging 0.92
R2961:Akna UTSW 4 63394944 missense probably benign 0.04
R3150:Akna UTSW 4 63395353 missense possibly damaging 0.80
R3552:Akna UTSW 4 63398124 start codon destroyed probably null 0.53
R3855:Akna UTSW 4 63373468 missense probably damaging 0.98
R4023:Akna UTSW 4 63374390 missense probably benign
R4247:Akna UTSW 4 63395172 missense probably benign 0.00
R4299:Akna UTSW 4 63398032 missense possibly damaging 0.59
R4422:Akna UTSW 4 63387093 missense possibly damaging 0.86
R4499:Akna UTSW 4 63395041 missense probably benign
R4723:Akna UTSW 4 63387032 missense probably benign
R4743:Akna UTSW 4 63378613 missense probably damaging 1.00
R4780:Akna UTSW 4 63379254 missense probably benign
R4903:Akna UTSW 4 63374037 missense probably damaging 1.00
R4936:Akna UTSW 4 63395265 missense probably damaging 0.97
R5041:Akna UTSW 4 63387144 missense possibly damaging 0.67
R5276:Akna UTSW 4 63368203 missense possibly damaging 0.95
R5297:Akna UTSW 4 63381846 missense possibly damaging 0.93
R5546:Akna UTSW 4 63394959 missense probably benign 0.15
R5546:Akna UTSW 4 63395566 missense probably benign
R5773:Akna UTSW 4 63395070 missense probably benign 0.41
R5966:Akna UTSW 4 63394903 missense probably damaging 0.99
R6127:Akna UTSW 4 63368119 missense possibly damaging 0.67
R6176:Akna UTSW 4 63377732 missense probably benign 0.04
R6337:Akna UTSW 4 63374003 missense probably benign 0.00
R6701:Akna UTSW 4 63395280 missense probably benign
R6800:Akna UTSW 4 63398031 missense probably benign
R6931:Akna UTSW 4 63387102 missense probably benign 0.02
R7451:Akna UTSW 4 63378667 missense probably benign 0.16
R7644:Akna UTSW 4 63395397 missense possibly damaging 0.48
R7786:Akna UTSW 4 63394962 missense probably benign
RF048:Akna UTSW 4 63377841 small deletion probably benign
Predicted Primers PCR Primer
(F):5'- GCCAGGAACGGAGTTCAGACAC -3'
(R):5'- CCATTGGCAGCACAAGGCAAAG -3'

Sequencing Primer
(F):5'- GATCTTCTGACCAGCCCAC -3'
(R):5'- tgtatgaggttcagagatggaaag -3'
Posted On2014-04-13