Mutagenetix > Incidental Mutation

Incidental Mutation 'R1575:Cadps2'

171088

Institutional Source

Beutler Lab

Gene Symbol

Cadps2

Ensembl Gene

ENSMUSG00000017978

Gene Name

Ca2+-dependent activator protein for secretion 2

Synonyms

Caps2, cpd2, A230044C21Rik

MMRRC Submission

039613-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1575 (G1)

Quality Score

182

Status

Validated

Chromosome

Chromosomal Location

23262773-23839421 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 23429218 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Phenylalanine at position 519 (V519F)

Ref Sequence

ENSEMBL: ENSMUSP00000128905 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000018122] [ENSMUST00000069074] [ENSMUST00000115356] [ENSMUST00000115358] [ENSMUST00000115361] [ENSMUST00000125350] [ENSMUST00000142913] [ENSMUST00000163871] [ENSMUST00000166458]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000018122
AA Change: V519F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000018122
Gene: ENSMUSG00000017978
AA Change: V519F

Domain	Start	End	E-Value	Type
low complexity region	5	21	N/A	INTRINSIC
low complexity region	31	65	N/A	INTRINSIC
low complexity region	114	126	N/A	INTRINSIC
coiled coil region	265	285	N/A	INTRINSIC
C2	369	467	1.51e-1	SMART
PH	492	596	2.94e-11	SMART
DUF1041	801	902	1.14e-52	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000069074
AA Change: V519F

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000064876
Gene: ENSMUSG00000017978
AA Change: V519F

Domain	Start	End	E-Value	Type
low complexity region	5	21	N/A	INTRINSIC
low complexity region	31	65	N/A	INTRINSIC
low complexity region	114	126	N/A	INTRINSIC
coiled coil region	265	285	N/A	INTRINSIC
C2	369	467	1.51e-1	SMART
PH	492	596	2.94e-11	SMART
DUF1041	801	895	5.54e-51	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000115356
AA Change: V519F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000111013
Gene: ENSMUSG00000017978
AA Change: V519F

Domain	Start	End	E-Value	Type
low complexity region	5	21	N/A	INTRINSIC
low complexity region	31	65	N/A	INTRINSIC
low complexity region	114	126	N/A	INTRINSIC
coiled coil region	265	285	N/A	INTRINSIC
C2	369	467	1.51e-1	SMART
PH	492	596	2.94e-11	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000115358
AA Change: V519F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000111015
Gene: ENSMUSG00000017978
AA Change: V519F

Domain	Start	End	E-Value	Type
low complexity region	5	21	N/A	INTRINSIC
low complexity region	31	65	N/A	INTRINSIC
low complexity region	114	126	N/A	INTRINSIC
coiled coil region	265	285	N/A	INTRINSIC
C2	369	467	1.51e-1	SMART
PH	492	596	2.94e-11	SMART
DUF1041	801	902	1.14e-52	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000115361
AA Change: V519F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000111018
Gene: ENSMUSG00000017978
AA Change: V519F

Domain	Start	End	E-Value	Type
low complexity region	5	21	N/A	INTRINSIC
low complexity region	31	65	N/A	INTRINSIC
low complexity region	114	126	N/A	INTRINSIC
coiled coil region	265	285	N/A	INTRINSIC
C2	369	467	1.51e-1	SMART
PH	492	596	2.94e-11	SMART
DUF1041	801	892	1.9e-49	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000125350
AA Change: V164F

PolyPhen 2 Score 0.937 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000115866
Gene: ENSMUSG00000017978
AA Change: V164F

Domain	Start	End	E-Value	Type
C2	14	112	1.51e-1	SMART
PH	137	241	2.94e-11	SMART
DUF1041	446	537	1.9e-49	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000142913
AA Change: V490F

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000138167
Gene: ENSMUSG00000017978
AA Change: V490F

Domain	Start	End	E-Value	Type
low complexity region	5	21	N/A	INTRINSIC
low complexity region	22	39	N/A	INTRINSIC
low complexity region	85	97	N/A	INTRINSIC
coiled coil region	236	256	N/A	INTRINSIC
C2	340	438	1.51e-1	SMART
PH	463	567	2.94e-11	SMART
DUF1041	772	873	1.14e-52	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000163871
AA Change: V519F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000128905
Gene: ENSMUSG00000017978
AA Change: V519F

Domain	Start	End	E-Value	Type
low complexity region	5	21	N/A	INTRINSIC
low complexity region	31	65	N/A	INTRINSIC
low complexity region	114	126	N/A	INTRINSIC
coiled coil region	265	285	N/A	INTRINSIC
C2	369	467	1.51e-1	SMART
PH	492	596	2.94e-11	SMART
DUF1041	801	902	7.2e-50	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000166458
AA Change: V490F

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000125972
Gene: ENSMUSG00000017978
AA Change: V490F

Domain	Start	End	E-Value	Type
low complexity region	5	21	N/A	INTRINSIC
low complexity region	85	97	N/A	INTRINSIC
coiled coil region	236	256	N/A	INTRINSIC
C2	340	438	1.51e-1	SMART
PH	463	567	2.94e-11	SMART
DUF1041	772	873	1.05e-51	SMART

Meta Mutation Damage Score

0.6788

Coding Region Coverage

1x: 99.1%
3x: 98.2%
10x: 96.0%
20x: 91.5%

Validation Efficiency

100% (72/72)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the calcium-dependent activator of secretion (CAPS) protein family, which are calcium binding proteins that regulate the exocytosis of synaptic and dense-core vesicles in neurons and neuroendocrine cells. Mutations in this gene may contribute to autism susceptibility. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2009]
PHENOTYPE: Mice homozygous for a null allele exhibit defects in cerebellum, Purkinje cell and interneuron morphology, paired-pulse facilitation, and behaviors including emotional behavior, vestibuoocular reflex, circadium and sleep patterns, social investigation and nurturing behavior. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 67 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgrl2	T	A	3: 148,852,762	T437S	probably benign	Het
Akna	A	G	4: 63,379,333	F828S	probably benign	Het
Alg9	G	T	9: 50,775,502	A40S	possibly damaging	Het
Alox8	T	A	11: 69,185,241	H628L	possibly damaging	Het
Aox3	T	C	1: 58,152,554	W422R	probably benign	Het
Atp13a4	T	C	16: 29,409,710	D984G	probably benign	Het
Bcam	T	C	7: 19,760,382	E363G	possibly damaging	Het
Calca	A	G	7: 114,635,161	Y18H	probably damaging	Het
Cd70	A	G	17: 57,146,364	I100T	probably damaging	Het
Cdk4	T	A	10: 127,064,651	H95Q	probably damaging	Het
Chchd1	T	A	14: 20,703,342	N11K	probably damaging	Het
Cma2	T	A	14: 55,972,815	N52K	probably damaging	Het
Cyp3a16	A	G	5: 145,436,457	V500A	probably benign	Het
Dicer1	A	G	12: 104,721,969		probably null	Het
Dnajc13	A	G	9: 104,156,838	S2206P	probably benign	Het
Dtl	T	C	1: 191,561,546		probably null	Het
Fam186b	T	C	15: 99,286,971	T24A	probably benign	Het
Fbxw21	A	G	9: 109,161,916	V25A	probably benign	Het
Gins1	T	C	2: 150,912,838	S45P	probably benign	Het
Gtpbp2	T	A	17: 46,165,943	V349D	probably damaging	Het
Hyal5	G	T	6: 24,876,793	D222Y	probably damaging	Het
Itgal	A	G	7: 127,300,888		probably null	Het
Klk14	A	G	7: 43,693,953		probably null	Het
Lama1	T	A	17: 67,810,409	L2518Q	possibly damaging	Het
Lrrc2	G	A	9: 110,979,487	G264D	probably benign	Het
Ltbp4	A	G	7: 27,322,820	S893P	probably damaging	Het
Mast4	G	A	13: 102,739,263	P1107L	probably damaging	Het
Mbd1	T	A	18: 74,275,419		probably null	Het
Naip2	A	T	13: 100,155,021	D1136E	probably benign	Het
Naip2	G	A	13: 100,155,029		probably benign	Het
Ncan	G	A	8: 70,110,198	T470I	probably benign	Het
Npy1r	A	T	8: 66,704,161	I78F	probably damaging	Het
Olfr1491	A	T	19: 13,705,525	M233L	probably benign	Het
Olfr917	G	A	9: 38,665,277	T189M	probably damaging	Het
Palb2	A	T	7: 122,110,838		probably null	Het
Pax3	T	C	1: 78,103,484	T422A	probably benign	Het
Pebp1	A	T	5: 117,286,164	D72E	possibly damaging	Het
Pnliprp1	A	T	19: 58,740,469	T363S	probably benign	Het
Rbm44	G	A	1: 91,156,843		probably null	Het
Rbm47	T	A	5: 66,025,015	Y425F	probably benign	Het
Robo3	G	T	9: 37,429,661	A83E	probably damaging	Het
Rrm1	A	G	7: 102,456,514	Y279C	probably damaging	Het
Rslcan18	A	T	13: 67,108,057		probably benign	Het
Scara5	C	A	14: 65,730,865	Q196K	probably benign	Het
Setd1b	C	T	5: 123,163,147		probably benign	Het
Siah1a	A	G	8: 86,725,241	F205S	probably damaging	Het
Smr2	AT	ATT	5: 88,108,824		probably null	Het
Ssu72	A	G	4: 155,731,357	D86G	probably benign	Het
St7	G	T	6: 17,886,111	K357N	probably damaging	Het
Sv2b	G	A	7: 75,147,677	T323I	probably damaging	Het
Syt1	T	C	10: 108,504,500	N319S	probably benign	Het
Tanc1	T	A	2: 59,791,651	F371L	probably damaging	Het
Tcf20	C	A	15: 82,855,492	G586V	probably benign	Het
Tg	T	C	15: 66,729,685		probably null	Het
Tyk2	A	T	9: 21,115,462	N620K	probably benign	Het
Ube2j1	T	A	4: 33,045,116	S130T	probably benign	Het
Ubr2	G	T	17: 46,932,492	P1696H	probably damaging	Het
Ubr5	A	T	15: 38,040,841	D266E	probably damaging	Het
Vipr2	A	G	12: 116,144,272	T426A	probably benign	Het
Vmn2r104	A	T	17: 20,042,215	W218R	probably damaging	Het
Vmn2r83	T	A	10: 79,479,122	N401K	probably damaging	Het
Vwf	A	G	6: 125,655,251	E82G	unknown	Het
Vwf	T	A	6: 125,663,571	Y2323*	probably null	Het
Wdr76	T	G	2: 121,528,921	V329G	probably damaging	Het
Zan	A	G	5: 137,461,952	C1226R	unknown	Het
Zbtb16	G	T	9: 48,832,272	Q247K	probably damaging	Het
Zfp541	T	C	7: 16,078,715	V431A	possibly damaging	Het

Other mutations in Cadps2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01014:Cadps2	APN	6	23496874	missense	possibly damaging	0.84
IGL01105:Cadps2	APN	6	23321700	splice site	probably benign
IGL01317:Cadps2	APN	6	23314173	missense	possibly damaging	0.76
IGL01409:Cadps2	APN	6	23587441	missense	probably damaging	1.00
IGL01477:Cadps2	APN	6	23263673	missense	probably damaging	1.00
IGL01620:Cadps2	APN	6	23587462	missense	probably benign	0.19
IGL01674:Cadps2	APN	6	23355852	missense	probably damaging	1.00
IGL01675:Cadps2	APN	6	23382905	missense	probably damaging	1.00
IGL01895:Cadps2	APN	6	23427275	missense	probably damaging	0.98
IGL02095:Cadps2	APN	6	23427310	missense	probably benign	0.01
IGL02200:Cadps2	APN	6	23385528	missense	probably damaging	1.00
IGL02380:Cadps2	APN	6	23287732	missense	probably benign	0.11
IGL02680:Cadps2	APN	6	23838896	missense	probably damaging	0.99
IGL02814:Cadps2	APN	6	23321707	missense	probably damaging	1.00
IGL02940:Cadps2	APN	6	23496809	missense	probably benign	0.08
IGL03061:Cadps2	APN	6	23287660	splice site	probably null
IGL03233:Cadps2	APN	6	23263601	missense	probably benign	0.10
R0193:Cadps2	UTSW	6	23599440	missense	probably benign	0.00
R0389:Cadps2	UTSW	6	23321782	missense	possibly damaging	0.88
R0571:Cadps2	UTSW	6	23583412	missense	probably damaging	1.00
R0595:Cadps2	UTSW	6	23321704	critical splice donor site	probably null
R0620:Cadps2	UTSW	6	23583396	missense	probably damaging	1.00
R0723:Cadps2	UTSW	6	23287698	missense	probably damaging	0.99
R0831:Cadps2	UTSW	6	23321740	missense	possibly damaging	0.88
R0836:Cadps2	UTSW	6	23328776	splice site	probably benign
R0942:Cadps2	UTSW	6	23263562	missense	probably damaging	1.00
R1099:Cadps2	UTSW	6	23599479	missense	probably damaging	1.00
R1120:Cadps2	UTSW	6	23838794	missense	probably damaging	1.00
R1216:Cadps2	UTSW	6	23583473	splice site	probably benign
R1780:Cadps2	UTSW	6	23320932	critical splice donor site	probably null
R1924:Cadps2	UTSW	6	23688858	missense	probably damaging	0.99
R1944:Cadps2	UTSW	6	23599480	missense	probably damaging	0.99
R1956:Cadps2	UTSW	6	23287686	missense	probably damaging	1.00
R1986:Cadps2	UTSW	6	23323380	missense	probably damaging	1.00
R2045:Cadps2	UTSW	6	23839122	missense	possibly damaging	0.73
R2146:Cadps2	UTSW	6	23838999	intron	probably benign
R2147:Cadps2	UTSW	6	23838999	intron	probably benign
R2148:Cadps2	UTSW	6	23838999	intron	probably benign
R2150:Cadps2	UTSW	6	23838999	intron	probably benign
R2219:Cadps2	UTSW	6	23410832	missense	probably damaging	1.00
R2264:Cadps2	UTSW	6	23323340	missense	probably benign	0.15
R2338:Cadps2	UTSW	6	23838978	splice site	probably benign
R3861:Cadps2	UTSW	6	23355861	missense	probably damaging	1.00
R3898:Cadps2	UTSW	6	23528126	missense	probably damaging	1.00
R3982:Cadps2	UTSW	6	23263531	utr 3 prime	probably benign
R4213:Cadps2	UTSW	6	23599463	missense	probably damaging	1.00
R4384:Cadps2	UTSW	6	23412988	missense	probably benign	0.18
R4432:Cadps2	UTSW	6	23626738	missense	probably damaging	0.99
R4609:Cadps2	UTSW	6	23587579	missense	probably damaging	1.00
R4806:Cadps2	UTSW	6	23688860	missense	probably damaging	0.96
R4977:Cadps2	UTSW	6	23599479	missense	probably damaging	1.00
R5174:Cadps2	UTSW	6	23287743	missense	probably damaging	1.00
R5267:Cadps2	UTSW	6	23626668	missense	possibly damaging	0.79
R5389:Cadps2	UTSW	6	23329104	missense	probably damaging	1.00
R5737:Cadps2	UTSW	6	23328805	missense	probably benign	0.28
R6074:Cadps2	UTSW	6	23626671	missense	probably damaging	1.00
R6254:Cadps2	UTSW	6	23329163	critical splice acceptor site	probably null
R6323:Cadps2	UTSW	6	23263578	missense	probably benign	0.04
R6463:Cadps2	UTSW	6	23323334	nonsense	probably null
R6907:Cadps2	UTSW	6	23599506	missense	probably damaging	1.00
R6940:Cadps2	UTSW	6	23302492	missense	probably damaging	1.00
R6964:Cadps2	UTSW	6	23583459	missense	probably damaging	1.00
R7079:Cadps2	UTSW	6	23323409	missense	probably damaging	1.00
R7139:Cadps2	UTSW	6	23410889	missense	probably damaging	1.00
R7156:Cadps2	UTSW	6	23688956	missense	probably benign	0.02
R7184:Cadps2	UTSW	6	23583429	missense	probably benign	0.18
R7325:Cadps2	UTSW	6	23409935	missense	unknown
R7526:Cadps2	UTSW	6	23496851	missense	probably damaging	1.00
R7546:Cadps2	UTSW	6	23626608	missense	probably benign	0.15
R7772:Cadps2	UTSW	6	23390446	missense	probably benign	0.00
R7870:Cadps2	UTSW	6	23263642	missense	probably benign	0.14
R8040:Cadps2	UTSW	6	23412943	splice site	probably benign
R8048:Cadps2	UTSW	6	23838863	missense	probably benign	0.14
R8082:Cadps2	UTSW	6	23323314	missense	probably damaging	1.00
R8100:Cadps2	UTSW	6	23838809	missense	probably damaging	1.00
R8115:Cadps2	UTSW	6	23328898	missense	probably benign	0.00
R8497:Cadps2	UTSW	6	23355919	missense	probably benign	0.27
R8768:Cadps2	UTSW	6	23382939	missense	probably damaging	1.00
R8783:Cadps2	UTSW	6	23302304	missense	possibly damaging	0.57
R8804:Cadps2	UTSW	6	23496806	missense	probably damaging	1.00
R8832:Cadps2	UTSW	6	23587537	missense	possibly damaging	0.52
R8848:Cadps2	UTSW	6	23344257	missense	probably damaging	1.00
R8854:Cadps2	UTSW	6	23385508	missense	probably damaging	1.00
R8896:Cadps2	UTSW	6	23410877	missense	probably damaging	1.00
R8910:Cadps2	UTSW	6	23344224	missense	probably benign	0.11
R8921:Cadps2	UTSW	6	23302301	missense	probably benign	0.00
R9228:Cadps2	UTSW	6	23688928	missense	probably benign	0.00
R9297:Cadps2	UTSW	6	23496888	missense	probably benign
R9318:Cadps2	UTSW	6	23496888	missense	probably benign
R9348:Cadps2	UTSW	6	23344263	missense	probably benign	0.20
R9447:Cadps2	UTSW	6	23323298	missense	probably damaging	0.96
R9484:Cadps2	UTSW	6	23626647	missense	probably benign	0.02
R9492:Cadps2	UTSW	6	23427239	missense	probably benign
R9630:Cadps2	UTSW	6	23587572	missense	probably benign	0.08
R9729:Cadps2	UTSW	6	23382983	missense	probably benign	0.28
Z1176:Cadps2	UTSW	6	23321801	missense	probably benign	0.24
Z1177:Cadps2	UTSW	6	23385478	missense	possibly damaging	0.88
Z1177:Cadps2	UTSW	6	23626695	missense	probably damaging	1.00
Z1177:Cadps2	UTSW	6	23838818	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGCAGGCATCCACACATGATTGG -3'
(R):5'- ACTGGACCGCCATTCTCATCATTTG -3'

Sequencing Primer
(F):5'- gtggtggtgggtggtgg -3'
(R):5'- TGACCTAAGAGATGCACTTCAG -3'

Posted On

2014-04-13