Incidental Mutation 'R1575:Ltbp4'
ID171094
Institutional Source Beutler Lab
Gene Symbol Ltbp4
Ensembl Gene ENSMUSG00000040488
Gene Namelatent transforming growth factor beta binding protein 4
Synonyms2310046A13Rik
MMRRC Submission 039613-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1575 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location27305136-27337692 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 27322820 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 893 (S893P)
Ref Sequence ENSEMBL: ENSMUSP00000113523 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038618] [ENSMUST00000108369] [ENSMUST00000118583] [ENSMUST00000118961] [ENSMUST00000121175]
Predicted Effect probably damaging
Transcript: ENSMUST00000038618
AA Change: S959P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000037536
Gene: ENSMUSG00000040488
AA Change: S959P

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
low complexity region 87 100 N/A INTRINSIC
low complexity region 112 125 N/A INTRINSIC
EGF 151 180 2.74e-3 SMART
low complexity region 244 265 N/A INTRINSIC
EGF_CA 356 396 3.51e-10 SMART
Pfam:TB 416 457 4.8e-15 PFAM
low complexity region 490 501 N/A INTRINSIC
low complexity region 507 568 N/A INTRINSIC
low complexity region 579 590 N/A INTRINSIC
EGF 591 629 6.06e-5 SMART
EGF_CA 630 671 8.3e-12 SMART
EGF_CA 672 713 7.34e-13 SMART
EGF_CA 714 751 8.43e-13 SMART
EGF_CA 753 794 1.66e-11 SMART
EGF_CA 795 836 3.61e-12 SMART
EGF_CA 837 876 5.61e-9 SMART
EGF_CA 877 919 1.73e-9 SMART
EGF_CA 920 961 7.12e-11 SMART
EGF_CA 962 1002 3.56e-11 SMART
EGF_CA 1003 1046 1.61e-9 SMART
EGF_CA 1047 1090 2.13e-9 SMART
EGF_CA 1091 1132 1.02e-11 SMART
EGF 1136 1175 1.69e1 SMART
low complexity region 1185 1223 N/A INTRINSIC
Pfam:TB 1234 1276 1.7e-13 PFAM
EGF_CA 1295 1337 2.72e-7 SMART
EGF_CA 1338 1379 1.36e-7 SMART
Pfam:TB 1402 1443 4.3e-14 PFAM
low complexity region 1449 1461 N/A INTRINSIC
low complexity region 1478 1500 N/A INTRINSIC
EGF 1578 1615 6.06e-5 SMART
EGF_CA 1616 1660 9.54e-12 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000108369
AA Change: S958P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000104006
Gene: ENSMUSG00000040488
AA Change: S958P

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
low complexity region 116 145 N/A INTRINSIC
EGF 150 179 2.74e-3 SMART
low complexity region 243 264 N/A INTRINSIC
EGF_CA 355 395 3.51e-10 SMART
Pfam:TB 414 456 2.5e-14 PFAM
low complexity region 489 500 N/A INTRINSIC
low complexity region 506 567 N/A INTRINSIC
low complexity region 578 589 N/A INTRINSIC
EGF 590 628 6.06e-5 SMART
EGF_CA 629 670 8.3e-12 SMART
EGF_CA 671 712 7.34e-13 SMART
EGF_CA 713 750 8.43e-13 SMART
EGF_CA 752 793 1.66e-11 SMART
EGF_CA 794 835 3.61e-12 SMART
EGF_CA 836 875 5.61e-9 SMART
EGF_CA 876 918 1.73e-9 SMART
EGF_CA 919 960 7.12e-11 SMART
EGF_CA 961 1001 3.56e-11 SMART
EGF_CA 1002 1045 1.61e-9 SMART
EGF_CA 1046 1089 2.13e-9 SMART
EGF_CA 1090 1131 1.02e-11 SMART
EGF 1135 1174 1.69e1 SMART
low complexity region 1184 1222 N/A INTRINSIC
Pfam:TB 1232 1275 2.4e-13 PFAM
EGF_CA 1294 1336 2.72e-7 SMART
EGF_CA 1337 1378 1.36e-7 SMART
Pfam:TB 1400 1442 7.6e-15 PFAM
low complexity region 1448 1460 N/A INTRINSIC
low complexity region 1477 1499 N/A INTRINSIC
EGF 1577 1614 6.06e-5 SMART
EGF_CA 1615 1659 9.54e-12 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000118583
AA Change: S893P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113523
Gene: ENSMUSG00000040488
AA Change: S893P

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
low complexity region 69 80 N/A INTRINSIC
EGF 85 114 2.74e-3 SMART
low complexity region 178 199 N/A INTRINSIC
EGF_CA 290 330 3.51e-10 SMART
Pfam:TB 349 391 2.3e-14 PFAM
low complexity region 424 435 N/A INTRINSIC
low complexity region 441 502 N/A INTRINSIC
low complexity region 513 524 N/A INTRINSIC
EGF 525 563 6.06e-5 SMART
EGF_CA 564 605 8.3e-12 SMART
EGF_CA 606 647 7.34e-13 SMART
EGF_CA 648 685 8.43e-13 SMART
EGF_CA 687 728 1.66e-11 SMART
EGF_CA 729 770 3.61e-12 SMART
EGF_CA 771 810 5.61e-9 SMART
EGF_CA 811 853 1.73e-9 SMART
EGF_CA 854 895 7.12e-11 SMART
EGF_CA 896 936 3.56e-11 SMART
EGF_CA 937 980 1.61e-9 SMART
EGF_CA 981 1024 2.13e-9 SMART
EGF_CA 1025 1066 1.02e-11 SMART
EGF 1070 1109 1.69e1 SMART
low complexity region 1119 1157 N/A INTRINSIC
Pfam:TB 1167 1210 2.2e-13 PFAM
EGF_CA 1229 1271 2.72e-7 SMART
EGF_CA 1272 1313 1.36e-7 SMART
Pfam:TB 1335 1377 7.1e-15 PFAM
low complexity region 1383 1395 N/A INTRINSIC
low complexity region 1412 1434 N/A INTRINSIC
EGF 1512 1549 6.06e-5 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000118961
AA Change: S893P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000113746
Gene: ENSMUSG00000040488
AA Change: S893P

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
low complexity region 69 80 N/A INTRINSIC
EGF 85 114 2.74e-3 SMART
low complexity region 178 199 N/A INTRINSIC
EGF_CA 290 330 3.51e-10 SMART
Pfam:TB 349 391 1.6e-14 PFAM
low complexity region 424 435 N/A INTRINSIC
low complexity region 441 502 N/A INTRINSIC
low complexity region 513 524 N/A INTRINSIC
EGF 525 563 6.06e-5 SMART
EGF_CA 564 605 8.3e-12 SMART
EGF_CA 606 647 7.34e-13 SMART
EGF_CA 648 685 8.43e-13 SMART
EGF_CA 687 728 1.66e-11 SMART
EGF_CA 729 770 3.61e-12 SMART
EGF_CA 771 810 5.61e-9 SMART
EGF_CA 811 853 1.73e-9 SMART
EGF_CA 854 895 7.12e-11 SMART
EGF_CA 896 936 3.56e-11 SMART
EGF_CA 937 980 1.61e-9 SMART
EGF_CA 981 1024 2.13e-9 SMART
EGF_CA 1025 1066 1.02e-11 SMART
EGF 1070 1109 1.69e1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000121175
AA Change: S893P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000113674
Gene: ENSMUSG00000040488
AA Change: S893P

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
low complexity region 69 80 N/A INTRINSIC
EGF 85 114 2.74e-3 SMART
low complexity region 178 199 N/A INTRINSIC
EGF_CA 290 330 3.51e-10 SMART
Pfam:TB 349 391 3.4e-14 PFAM
low complexity region 424 435 N/A INTRINSIC
low complexity region 441 502 N/A INTRINSIC
low complexity region 513 524 N/A INTRINSIC
EGF 525 563 6.06e-5 SMART
EGF_CA 564 605 8.3e-12 SMART
EGF_CA 606 647 7.34e-13 SMART
EGF_CA 648 685 8.43e-13 SMART
EGF_CA 687 728 1.66e-11 SMART
EGF_CA 729 770 3.61e-12 SMART
EGF_CA 771 810 5.61e-9 SMART
EGF_CA 811 853 1.73e-9 SMART
EGF_CA 854 895 7.12e-11 SMART
EGF_CA 896 936 3.56e-11 SMART
EGF_CA 937 980 1.61e-9 SMART
EGF_CA 981 1024 2.13e-9 SMART
EGF_CA 1025 1066 1.02e-11 SMART
EGF 1070 1109 1.69e1 SMART
low complexity region 1119 1157 N/A INTRINSIC
Pfam:TB 1167 1210 3.3e-13 PFAM
EGF_CA 1229 1271 2.72e-7 SMART
EGF_CA 1272 1313 1.36e-7 SMART
Pfam:TB 1335 1377 1e-14 PFAM
low complexity region 1383 1395 N/A INTRINSIC
low complexity region 1412 1434 N/A INTRINSIC
EGF 1512 1549 6.06e-5 SMART
EGF_CA 1550 1594 9.54e-12 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206413
Meta Mutation Damage Score 0.3527 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.5%
Validation Efficiency 100% (72/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene binds transforming growth factor beta (TGFB) as it is secreted and targeted to the extracellular matrix. TGFB is biologically latent after secretion and insertion into the extracellular matrix, and sheds TGFB and other proteins upon activation. Defects in this gene may be a cause of cutis laxa and severe pulmonary, gastrointestinal, and urinary abnormalities. Three transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, May 2010]
PHENOTYPE: Homozygous disruption of this locus results in pulmonary emphysema, cardiomyopathy, and colon cancer. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrl2 T A 3: 148,852,762 T437S probably benign Het
Akna A G 4: 63,379,333 F828S probably benign Het
Alg9 G T 9: 50,775,502 A40S possibly damaging Het
Alox8 T A 11: 69,185,241 H628L possibly damaging Het
Aox3 T C 1: 58,152,554 W422R probably benign Het
Atp13a4 T C 16: 29,409,710 D984G probably benign Het
Bcam T C 7: 19,760,382 E363G possibly damaging Het
Cadps2 C A 6: 23,429,218 V519F probably damaging Het
Calca A G 7: 114,635,161 Y18H probably damaging Het
Cd70 A G 17: 57,146,364 I100T probably damaging Het
Cdk4 T A 10: 127,064,651 H95Q probably damaging Het
Chchd1 T A 14: 20,703,342 N11K probably damaging Het
Cma2 T A 14: 55,972,815 N52K probably damaging Het
Cyp3a16 A G 5: 145,436,457 V500A probably benign Het
Dicer1 A G 12: 104,721,969 probably null Het
Dnajc13 A G 9: 104,156,838 S2206P probably benign Het
Dtl T C 1: 191,561,546 probably null Het
Fam186b T C 15: 99,286,971 T24A probably benign Het
Fbxw21 A G 9: 109,161,916 V25A probably benign Het
Gins1 T C 2: 150,912,838 S45P probably benign Het
Gtpbp2 T A 17: 46,165,943 V349D probably damaging Het
Hyal5 G T 6: 24,876,793 D222Y probably damaging Het
Itgal A G 7: 127,300,888 probably null Het
Klk14 A G 7: 43,693,953 probably null Het
Lama1 T A 17: 67,810,409 L2518Q possibly damaging Het
Lrrc2 G A 9: 110,979,487 G264D probably benign Het
Mast4 G A 13: 102,739,263 P1107L probably damaging Het
Mbd1 T A 18: 74,275,419 probably null Het
Naip2 A T 13: 100,155,021 D1136E probably benign Het
Naip2 G A 13: 100,155,029 probably benign Het
Ncan G A 8: 70,110,198 T470I probably benign Het
Npy1r A T 8: 66,704,161 I78F probably damaging Het
Olfr1491 A T 19: 13,705,525 M233L probably benign Het
Olfr917 G A 9: 38,665,277 T189M probably damaging Het
Palb2 A T 7: 122,110,838 probably null Het
Pax3 T C 1: 78,103,484 T422A probably benign Het
Pebp1 A T 5: 117,286,164 D72E possibly damaging Het
Pnliprp1 A T 19: 58,740,469 T363S probably benign Het
Rbm44 G A 1: 91,156,843 probably null Het
Rbm47 T A 5: 66,025,015 Y425F probably benign Het
Robo3 G T 9: 37,429,661 A83E probably damaging Het
Rrm1 A G 7: 102,456,514 Y279C probably damaging Het
Rslcan18 A T 13: 67,108,057 probably benign Het
Scara5 C A 14: 65,730,865 Q196K probably benign Het
Setd1b C T 5: 123,163,147 probably benign Het
Siah1a A G 8: 86,725,241 F205S probably damaging Het
Smr2 AT ATT 5: 88,108,824 probably null Het
Ssu72 A G 4: 155,731,357 D86G probably benign Het
St7 G T 6: 17,886,111 K357N probably damaging Het
Sv2b G A 7: 75,147,677 T323I probably damaging Het
Syt1 T C 10: 108,504,500 N319S probably benign Het
Tanc1 T A 2: 59,791,651 F371L probably damaging Het
Tcf20 C A 15: 82,855,492 G586V probably benign Het
Tg T C 15: 66,729,685 probably null Het
Tyk2 A T 9: 21,115,462 N620K probably benign Het
Ube2j1 T A 4: 33,045,116 S130T probably benign Het
Ubr2 G T 17: 46,932,492 P1696H probably damaging Het
Ubr5 A T 15: 38,040,841 D266E probably damaging Het
Vipr2 A G 12: 116,144,272 T426A probably benign Het
Vmn2r104 A T 17: 20,042,215 W218R probably damaging Het
Vmn2r83 T A 10: 79,479,122 N401K probably damaging Het
Vwf A G 6: 125,655,251 E82G unknown Het
Vwf T A 6: 125,663,571 Y2323* probably null Het
Wdr76 T G 2: 121,528,921 V329G probably damaging Het
Zan A G 5: 137,461,952 C1226R unknown Het
Zbtb16 G T 9: 48,832,272 Q247K probably damaging Het
Zfp541 T C 7: 16,078,715 V431A possibly damaging Het
Other mutations in Ltbp4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00434:Ltbp4 APN 7 27328805 missense probably damaging 0.96
IGL00585:Ltbp4 APN 7 27326733 missense probably damaging 0.98
IGL01320:Ltbp4 APN 7 27328359 splice site probably benign
IGL01860:Ltbp4 APN 7 27319646 missense probably damaging 1.00
IGL02026:Ltbp4 APN 7 27327417 nonsense probably null
IGL02226:Ltbp4 APN 7 27306934 missense probably damaging 1.00
IGL02422:Ltbp4 APN 7 27319672 missense probably damaging 1.00
IGL02611:Ltbp4 APN 7 27310655 missense probably damaging 1.00
IGL02892:Ltbp4 APN 7 27310649 missense probably damaging 1.00
IGL02926:Ltbp4 APN 7 27328872 splice site probably null
IGL02950:Ltbp4 APN 7 27306718 missense probably damaging 0.99
IGL03008:Ltbp4 APN 7 27324364 missense probably damaging 0.99
IGL03271:Ltbp4 APN 7 27329815 missense unknown
IGL02837:Ltbp4 UTSW 7 27314381 missense probably damaging 1.00
R0792:Ltbp4 UTSW 7 27325060 missense probably damaging 1.00
R0980:Ltbp4 UTSW 7 27324162 missense probably damaging 1.00
R1017:Ltbp4 UTSW 7 27306076 missense possibly damaging 0.95
R1185:Ltbp4 UTSW 7 27310535 missense probably damaging 1.00
R1185:Ltbp4 UTSW 7 27310535 missense probably damaging 1.00
R1185:Ltbp4 UTSW 7 27310535 missense probably damaging 1.00
R1403:Ltbp4 UTSW 7 27329039 missense unknown
R1403:Ltbp4 UTSW 7 27329039 missense unknown
R1448:Ltbp4 UTSW 7 27306577 missense possibly damaging 0.86
R1918:Ltbp4 UTSW 7 27337569 unclassified probably benign
R1932:Ltbp4 UTSW 7 27307766 critical splice donor site probably null
R1959:Ltbp4 UTSW 7 27329018 missense unknown
R1960:Ltbp4 UTSW 7 27329018 missense unknown
R1976:Ltbp4 UTSW 7 27326770 missense probably damaging 1.00
R2060:Ltbp4 UTSW 7 27308953 missense probably damaging 1.00
R2333:Ltbp4 UTSW 7 27327778 missense possibly damaging 0.82
R2431:Ltbp4 UTSW 7 27319676 missense possibly damaging 0.91
R3125:Ltbp4 UTSW 7 27327778 missense possibly damaging 0.82
R4093:Ltbp4 UTSW 7 27325216 missense possibly damaging 0.93
R4095:Ltbp4 UTSW 7 27325216 missense possibly damaging 0.93
R4592:Ltbp4 UTSW 7 27325183 missense probably damaging 0.96
R4610:Ltbp4 UTSW 7 27306700 missense probably damaging 1.00
R4650:Ltbp4 UTSW 7 27314309 missense probably damaging 1.00
R4912:Ltbp4 UTSW 7 27306116 nonsense probably null
R5002:Ltbp4 UTSW 7 27327685 frame shift probably null
R5016:Ltbp4 UTSW 7 27327685 frame shift probably null
R5216:Ltbp4 UTSW 7 27327311 small deletion probably benign
R5218:Ltbp4 UTSW 7 27327311 small deletion probably benign
R5219:Ltbp4 UTSW 7 27327311 small deletion probably benign
R5219:Ltbp4 UTSW 7 27327321 missense probably benign 0.01
R5539:Ltbp4 UTSW 7 27327724 missense probably damaging 0.97
R5991:Ltbp4 UTSW 7 27309316 missense probably damaging 1.00
R6082:Ltbp4 UTSW 7 27335680 unclassified probably benign
R6125:Ltbp4 UTSW 7 27327755 missense probably damaging 1.00
R6146:Ltbp4 UTSW 7 27319724 missense probably damaging 0.99
R6156:Ltbp4 UTSW 7 27330162 missense unknown
R6414:Ltbp4 UTSW 7 27310715 missense probably damaging 1.00
R6563:Ltbp4 UTSW 7 27309063 missense probably damaging 1.00
R6719:Ltbp4 UTSW 7 27328763 missense probably damaging 0.99
R6940:Ltbp4 UTSW 7 27308944 missense probably damaging 1.00
R7054:Ltbp4 UTSW 7 27307766 critical splice donor site probably null
R7116:Ltbp4 UTSW 7 27305427 missense probably damaging 0.99
R7326:Ltbp4 UTSW 7 27329755 missense unknown
R7419:Ltbp4 UTSW 7 27329767 missense unknown
X0025:Ltbp4 UTSW 7 27325802 missense probably damaging 1.00
X0066:Ltbp4 UTSW 7 27306065 critical splice donor site probably null
Z1088:Ltbp4 UTSW 7 27307792 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTTCCAACTTCCTGACACATCCAG -3'
(R):5'- ACCAACGCTTTTCTCCAGTGAATCC -3'

Sequencing Primer
(F):5'- TGACACATCCAGTTCCTCTTTG -3'
(R):5'- ACCCACTCTTACAGATGTGGATG -3'
Posted On2014-04-13