Mutagenetix > Incidental Mutations

Incidental Mutation 'R1575:Rrm1'

171097

Institutional Source

Beutler Lab

Gene Symbol

Rrm1

Ensembl Gene

ENSMUSG00000030978

Gene Name

ribonucleotide reductase M1

Synonyms

RnrM1

MMRRC Submission

039613-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.970) question?

Stock #

R1575 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

102441695-102469771 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 102456514 bp

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 279 (Y279C)

Ref Sequence

ENSEMBL: ENSMUSP00000033283 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000033283]

Predicted Effect

probably damaging
Transcript: ENSMUST00000033283
AA Change: Y279C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000033283
Gene: ENSMUSG00000030978
AA Change: Y279C

Domain	Start	End	E-Value	Type
Pfam:ATP-cone	1	89	8.7e-21	PFAM
Pfam:Ribonuc_red_lgN	141	213	2.8e-25	PFAM
Pfam:Ribonuc_red_lgC	216	738	1.6e-197	PFAM
coiled coil region	749	778	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000209955

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000211493

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000211786

Meta Mutation Damage Score

0.9033

Coding Region Coverage

1x: 99.1%
3x: 98.2%
10x: 96.0%
20x: 91.5%

Validation Efficiency

100% (72/72)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the large and catalytic subunit of ribonucleotide reductase, an enzyme essential for the conversion of ribonucleotides into deoxyribonucleotides. A pool of available deoxyribonucleotides is important for DNA replication during S phase of the cell cycle as well as multiple DNA repair processes. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic letahlity before E3.5. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 67 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgrl2	T	A	3: 148,852,762	T437S	probably benign	Het
Akna	A	G	4: 63,379,333	F828S	probably benign	Het
Alg9	G	T	9: 50,775,502	A40S	possibly damaging	Het
Alox8	T	A	11: 69,185,241	H628L	possibly damaging	Het
Aox3	T	C	1: 58,152,554	W422R	probably benign	Het
Atp13a4	T	C	16: 29,409,710	D984G	probably benign	Het
Bcam	T	C	7: 19,760,382	E363G	possibly damaging	Het
Cadps2	C	A	6: 23,429,218	V519F	probably damaging	Het
Calca	A	G	7: 114,635,161	Y18H	probably damaging	Het
Cd70	A	G	17: 57,146,364	I100T	probably damaging	Het
Cdk4	T	A	10: 127,064,651	H95Q	probably damaging	Het
Chchd1	T	A	14: 20,703,342	N11K	probably damaging	Het
Cma2	T	A	14: 55,972,815	N52K	probably damaging	Het
Cyp3a16	A	G	5: 145,436,457	V500A	probably benign	Het
Dicer1	A	G	12: 104,721,969		probably null	Het
Dnajc13	A	G	9: 104,156,838	S2206P	probably benign	Het
Dtl	T	C	1: 191,561,546		probably null	Het
Fam186b	T	C	15: 99,286,971	T24A	probably benign	Het
Fbxw21	A	G	9: 109,161,916	V25A	probably benign	Het
Gins1	T	C	2: 150,912,838	S45P	probably benign	Het
Gtpbp2	T	A	17: 46,165,943	V349D	probably damaging	Het
Hyal5	G	T	6: 24,876,793	D222Y	probably damaging	Het
Itgal	A	G	7: 127,300,888		probably null	Het
Klk14	A	G	7: 43,693,953		probably null	Het
Lama1	T	A	17: 67,810,409	L2518Q	possibly damaging	Het
Lrrc2	G	A	9: 110,979,487	G264D	probably benign	Het
Ltbp4	A	G	7: 27,322,820	S893P	probably damaging	Het
Mast4	G	A	13: 102,739,263	P1107L	probably damaging	Het
Mbd1	T	A	18: 74,275,419		probably null	Het
Naip2	A	T	13: 100,155,021	D1136E	probably benign	Het
Naip2	G	A	13: 100,155,029		probably benign	Het
Ncan	G	A	8: 70,110,198	T470I	probably benign	Het
Npy1r	A	T	8: 66,704,161	I78F	probably damaging	Het
Olfr1491	A	T	19: 13,705,525	M233L	probably benign	Het
Olfr917	G	A	9: 38,665,277	T189M	probably damaging	Het
Palb2	A	T	7: 122,110,838		probably null	Het
Pax3	T	C	1: 78,103,484	T422A	probably benign	Het
Pebp1	A	T	5: 117,286,164	D72E	possibly damaging	Het
Pnliprp1	A	T	19: 58,740,469	T363S	probably benign	Het
Rbm44	G	A	1: 91,156,843		probably null	Het
Rbm47	T	A	5: 66,025,015	Y425F	probably benign	Het
Robo3	G	T	9: 37,429,661	A83E	probably damaging	Het
Rslcan18	A	T	13: 67,108,057		probably benign	Het
Scara5	C	A	14: 65,730,865	Q196K	probably benign	Het
Setd1b	C	T	5: 123,163,147		probably benign	Het
Siah1a	A	G	8: 86,725,241	F205S	probably damaging	Het
Smr2	AT	ATT	5: 88,108,824		probably null	Het
Ssu72	A	G	4: 155,731,357	D86G	probably benign	Het
St7	G	T	6: 17,886,111	K357N	probably damaging	Het
Sv2b	G	A	7: 75,147,677	T323I	probably damaging	Het
Syt1	T	C	10: 108,504,500	N319S	probably benign	Het
Tanc1	T	A	2: 59,791,651	F371L	probably damaging	Het
Tcf20	C	A	15: 82,855,492	G586V	probably benign	Het
Tg	T	C	15: 66,729,685		probably null	Het
Tyk2	A	T	9: 21,115,462	N620K	probably benign	Het
Ube2j1	T	A	4: 33,045,116	S130T	probably benign	Het
Ubr2	G	T	17: 46,932,492	P1696H	probably damaging	Het
Ubr5	A	T	15: 38,040,841	D266E	probably damaging	Het
Vipr2	A	G	12: 116,144,272	T426A	probably benign	Het
Vmn2r104	A	T	17: 20,042,215	W218R	probably damaging	Het
Vmn2r83	T	A	10: 79,479,122	N401K	probably damaging	Het
Vwf	A	G	6: 125,655,251	E82G	unknown	Het
Vwf	T	A	6: 125,663,571	Y2323*	probably null	Het
Wdr76	T	G	2: 121,528,921	V329G	probably damaging	Het
Zan	A	G	5: 137,461,952	C1226R	unknown	Het
Zbtb16	G	T	9: 48,832,272	Q247K	probably damaging	Het
Zfp541	T	C	7: 16,078,715	V431A	possibly damaging	Het

Other mutations in Rrm1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00087:Rrm1	APN	7	102454507	nonsense	probably null
IGL01431:Rrm1	APN	7	102457552	splice site	probably benign
IGL03251:Rrm1	APN	7	102457206	missense	probably damaging	1.00
IGL03401:Rrm1	APN	7	102465744	missense	possibly damaging	0.81
R0454:Rrm1	UTSW	7	102466926	missense	probably damaging	1.00
R0548:Rrm1	UTSW	7	102467067	critical splice donor site	probably null
R0759:Rrm1	UTSW	7	102457561	missense	probably benign	0.32
R1586:Rrm1	UTSW	7	102466905	makesense	probably null
R1625:Rrm1	UTSW	7	102468347	missense	probably damaging	0.98
R2207:Rrm1	UTSW	7	102442026	start codon destroyed	probably null	0.98
R2432:Rrm1	UTSW	7	102443072	missense	probably benign	0.03
R2513:Rrm1	UTSW	7	102460689	missense	probably damaging	0.99
R3796:Rrm1	UTSW	7	102465703	splice site	probably null
R3914:Rrm1	UTSW	7	102457174	missense	probably damaging	1.00
R4179:Rrm1	UTSW	7	102457198	missense	probably damaging	1.00
R4302:Rrm1	UTSW	7	102447824	missense	probably benign	0.00
R4379:Rrm1	UTSW	7	102446593	missense	probably damaging	1.00
R4416:Rrm1	UTSW	7	102447801	missense	probably benign	0.06
R4690:Rrm1	UTSW	7	102447879	missense	probably benign
R4939:Rrm1	UTSW	7	102466924	missense	probably benign	0.34
R5433:Rrm1	UTSW	7	102465767	missense	probably damaging	0.97
R5445:Rrm1	UTSW	7	102451023	missense	possibly damaging	0.77
R6120:Rrm1	UTSW	7	102460856	splice site	probably null
R6198:Rrm1	UTSW	7	102446729	critical splice donor site	probably null
R6369:Rrm1	UTSW	7	102446702	missense	probably damaging	0.97
R6699:Rrm1	UTSW	7	102460825	missense	probably damaging	1.00
R7009:Rrm1	UTSW	7	102460334	missense	probably damaging	1.00
R7491:Rrm1	UTSW	7	102454557	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGTGGGGAGTAGCTCAAACTTCATAGAT -3'
(R):5'- GGGCGCTAAAGGTAAATAAGTCAGCA -3'

Sequencing Primer
(F):5'- GCTCAAACTTCATAGATGGGTTCC -3'
(R):5'- caccacattcacactcacaac -3'

Posted On

2014-04-13