Incidental Mutation 'R1575:Calca'
ID 171098
Institutional Source Beutler Lab
Gene Symbol Calca
Ensembl Gene ENSMUSG00000030669
Gene Name calcitonin/calcitonin-related polypeptide, alpha
Synonyms alpha CGRP, CT, Ct, CA, Calc, Ctn, Cgrp
MMRRC Submission 039613-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.241) question?
Stock # R1575 (G1)
Quality Score 116
Status Validated
Chromosome 7
Chromosomal Location 114631478-114636357 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 114635161 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 18 (Y18H)
Ref Sequence ENSEMBL: ENSMUSP00000032906 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032906] [ENSMUST00000032907] [ENSMUST00000205714] [ENSMUST00000205933] [ENSMUST00000206156] [ENSMUST00000206853]
AlphaFold P70160
Predicted Effect probably damaging
Transcript: ENSMUST00000032906
AA Change: Y18H

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000032906
Gene: ENSMUSG00000030669
AA Change: Y18H

low complexity region 63 73 N/A INTRINSIC
CALCITONIN 81 123 3.93e-18 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000032907
AA Change: Y18H

PolyPhen 2 Score 0.638 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000032907
Gene: ENSMUSG00000030669
AA Change: Y18H

low complexity region 63 73 N/A INTRINSIC
CALCITONIN 83 120 4.54e-23 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205560
Predicted Effect probably benign
Transcript: ENSMUST00000205714
AA Change: Y18H

PolyPhen 2 Score 0.378 (Sensitivity: 0.90; Specificity: 0.89)
Predicted Effect probably benign
Transcript: ENSMUST00000205933
AA Change: Y18H

PolyPhen 2 Score 0.378 (Sensitivity: 0.90; Specificity: 0.89)
Predicted Effect probably benign
Transcript: ENSMUST00000206156
AA Change: Y18H

PolyPhen 2 Score 0.378 (Sensitivity: 0.90; Specificity: 0.89)
Predicted Effect possibly damaging
Transcript: ENSMUST00000206853
AA Change: Y18H

PolyPhen 2 Score 0.638 (Sensitivity: 0.87; Specificity: 0.91)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.5%
Validation Efficiency 100% (72/72)
MGI Phenotype FUNCTION: This gene encodes the peptide hormones calcitonin, calcitonin gene-related peptide (CGRP) and katacalcin. Alternative splicing of the mRNA results in multiple variants that encode either calcitonin or CGRP preproproteins. Post-translational processing of the calcitonin and CGRP propeptides results in either calcitonin and katacalcin, or CGRP, respectively. Calcitonin and katacalcin modulate calcium levels in the blood stream. CGRP can function as a vasodilator and play a role in the transmission of pain. The human homolog of CGRP was found to have antimicrobial activity. [provided by RefSeq, Mar 2015]
PHENOTYPE: Two separate peptides, calcitonin and calcitonin gene related peptide-alpha (CGRP-alpha), are derived from this locus by alternative splicing. Mice homozygous null for CGRP-alpha have changes in the vascular and nervous system. Mice lacking calcitonin have increased bone mineralization. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrl2 T A 3: 148,852,762 T437S probably benign Het
Akna A G 4: 63,379,333 F828S probably benign Het
Alg9 G T 9: 50,775,502 A40S possibly damaging Het
Alox8 T A 11: 69,185,241 H628L possibly damaging Het
Aox3 T C 1: 58,152,554 W422R probably benign Het
Atp13a4 T C 16: 29,409,710 D984G probably benign Het
Bcam T C 7: 19,760,382 E363G possibly damaging Het
Cadps2 C A 6: 23,429,218 V519F probably damaging Het
Cd70 A G 17: 57,146,364 I100T probably damaging Het
Cdk4 T A 10: 127,064,651 H95Q probably damaging Het
Chchd1 T A 14: 20,703,342 N11K probably damaging Het
Cma2 T A 14: 55,972,815 N52K probably damaging Het
Cyp3a16 A G 5: 145,436,457 V500A probably benign Het
Dicer1 A G 12: 104,721,969 probably null Het
Dnajc13 A G 9: 104,156,838 S2206P probably benign Het
Dtl T C 1: 191,561,546 probably null Het
Fam186b T C 15: 99,286,971 T24A probably benign Het
Fbxw21 A G 9: 109,161,916 V25A probably benign Het
Gins1 T C 2: 150,912,838 S45P probably benign Het
Gtpbp2 T A 17: 46,165,943 V349D probably damaging Het
Hyal5 G T 6: 24,876,793 D222Y probably damaging Het
Itgal A G 7: 127,300,888 probably null Het
Klk14 A G 7: 43,693,953 probably null Het
Lama1 T A 17: 67,810,409 L2518Q possibly damaging Het
Lrrc2 G A 9: 110,979,487 G264D probably benign Het
Ltbp4 A G 7: 27,322,820 S893P probably damaging Het
Mast4 G A 13: 102,739,263 P1107L probably damaging Het
Mbd1 T A 18: 74,275,419 probably null Het
Naip2 A T 13: 100,155,021 D1136E probably benign Het
Naip2 G A 13: 100,155,029 probably benign Het
Ncan G A 8: 70,110,198 T470I probably benign Het
Npy1r A T 8: 66,704,161 I78F probably damaging Het
Olfr1491 A T 19: 13,705,525 M233L probably benign Het
Olfr917 G A 9: 38,665,277 T189M probably damaging Het
Palb2 A T 7: 122,110,838 probably null Het
Pax3 T C 1: 78,103,484 T422A probably benign Het
Pebp1 A T 5: 117,286,164 D72E possibly damaging Het
Pnliprp1 A T 19: 58,740,469 T363S probably benign Het
Rbm44 G A 1: 91,156,843 probably null Het
Rbm47 T A 5: 66,025,015 Y425F probably benign Het
Robo3 G T 9: 37,429,661 A83E probably damaging Het
Rrm1 A G 7: 102,456,514 Y279C probably damaging Het
Rslcan18 A T 13: 67,108,057 probably benign Het
Scara5 C A 14: 65,730,865 Q196K probably benign Het
Setd1b C T 5: 123,163,147 probably benign Het
Siah1a A G 8: 86,725,241 F205S probably damaging Het
Smr2 AT ATT 5: 88,108,824 probably null Het
Ssu72 A G 4: 155,731,357 D86G probably benign Het
St7 G T 6: 17,886,111 K357N probably damaging Het
Sv2b G A 7: 75,147,677 T323I probably damaging Het
Syt1 T C 10: 108,504,500 N319S probably benign Het
Tanc1 T A 2: 59,791,651 F371L probably damaging Het
Tcf20 C A 15: 82,855,492 G586V probably benign Het
Tg T C 15: 66,729,685 probably null Het
Tyk2 A T 9: 21,115,462 N620K probably benign Het
Ube2j1 T A 4: 33,045,116 S130T probably benign Het
Ubr2 G T 17: 46,932,492 P1696H probably damaging Het
Ubr5 A T 15: 38,040,841 D266E probably damaging Het
Vipr2 A G 12: 116,144,272 T426A probably benign Het
Vmn2r104 A T 17: 20,042,215 W218R probably damaging Het
Vmn2r83 T A 10: 79,479,122 N401K probably damaging Het
Vwf A G 6: 125,655,251 E82G unknown Het
Vwf T A 6: 125,663,571 Y2323* probably null Het
Wdr76 T G 2: 121,528,921 V329G probably damaging Het
Zan A G 5: 137,461,952 C1226R unknown Het
Zbtb16 G T 9: 48,832,272 Q247K probably damaging Het
Zfp541 T C 7: 16,078,715 V431A possibly damaging Het
Other mutations in Calca
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03064:Calca APN 7 114633684 missense probably benign 0.03
R1244:Calca UTSW 7 114633727 missense probably damaging 1.00
R1599:Calca UTSW 7 114634472 missense probably damaging 1.00
R1892:Calca UTSW 7 114633727 missense probably damaging 1.00
R3692:Calca UTSW 7 114634561 missense probably damaging 1.00
R7985:Calca UTSW 7 114635178 missense possibly damaging 0.61
R8087:Calca UTSW 7 114632574 missense probably benign 0.01
R8181:Calca UTSW 7 114635152 missense probably benign 0.00
Predicted Primers PCR Primer

Sequencing Primer
(F):5'- ttattggcaagttagcagattagag -3'
Posted On 2014-04-13