Mutagenetix > Incidental Mutation

Incidental Mutation 'R1575:Itgal'

171100

Institutional Source

Beutler Lab

Gene Symbol

Itgal

Ensembl Gene

ENSMUSG00000030830

Gene Name

integrin alpha L

Synonyms

LFA-1, Ly-21, Cd11a, Ly-15

MMRRC Submission

039613-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.164) question?

Stock #

R1575 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

127296260-127335138 bp(+) (GRCm38)

Type of Mutation

critical splice acceptor site

DNA Base Change (assembly)

A to G at 127300888 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000131847 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000106306] [ENSMUST00000117762] [ENSMUST00000120857] [ENSMUST00000170971]

AlphaFold

P24063

Predicted Effect

probably null
Transcript: ENSMUST00000106306

SMART Domains

Protein: ENSMUSP00000101913
Gene: ENSMUSG00000030830

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
Int_alpha	38	81	5.01e0	SMART
VWA	151	327	2.68e-32	SMART
Int_alpha	398	450	1.27e-6	SMART
Int_alpha	454	509	9.6e-7	SMART
Int_alpha	515	568	3.58e-15	SMART
Int_alpha	575	624	1.28e1	SMART
low complexity region	1043	1059	N/A	INTRINSIC
transmembrane domain	1087	1109	N/A	INTRINSIC
Pfam:Integrin_alpha	1110	1124	5.8e-7	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000117762

SMART Domains

Protein: ENSMUSP00000113946
Gene: ENSMUSG00000030830

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
Int_alpha	38	81	5.01e0	SMART
VWA	151	327	2.68e-32	SMART
Int_alpha	398	450	1.27e-6	SMART
Int_alpha	454	509	9.6e-7	SMART
Int_alpha	515	568	3.58e-15	SMART
Int_alpha	575	624	1.28e1	SMART
low complexity region	1042	1058	N/A	INTRINSIC
transmembrane domain	1086	1108	N/A	INTRINSIC
Pfam:Integrin_alpha	1109	1123	5.8e-7	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000120857

SMART Domains

Protein: ENSMUSP00000113396
Gene: ENSMUSG00000030830

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
Int_alpha	38	81	5.01e0	SMART
VWA	151	327	2.68e-32	SMART
Int_alpha	398	450	1.27e-6	SMART
Int_alpha	454	509	9.6e-7	SMART
Int_alpha	515	568	3.58e-15	SMART
Int_alpha	575	624	1.28e1	SMART
low complexity region	1042	1058	N/A	INTRINSIC
transmembrane domain	1086	1108	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000170971

SMART Domains

Protein: ENSMUSP00000131847
Gene: ENSMUSG00000030830

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
Int_alpha	38	81	5.01e0	SMART
VWA	151	327	2.68e-32	SMART
Int_alpha	398	450	1.27e-6	SMART
Int_alpha	454	509	9.6e-7	SMART
Int_alpha	515	568	3.58e-15	SMART
Int_alpha	575	624	1.28e1	SMART
low complexity region	1042	1058	N/A	INTRINSIC
transmembrane domain	1086	1108	N/A	INTRINSIC
Pfam:Integrin_alpha	1109	1123	1.2e-6	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000205695

Meta Mutation Damage Score

0.9585

Coding Region Coverage

1x: 99.1%
3x: 98.2%
10x: 96.0%
20x: 91.5%

Validation Efficiency

100% (72/72)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] ITGAL encodes the integrin alpha L chain. Integrins are heterodimeric integral membrane proteins composed of an alpha chain and a beta chain. This I-domain containing alpha integrin combines with the beta 2 chain (ITGB2) to form the integrin lymphocyte function-associated antigen-1 (LFA-1), which is expressed on all leukocytes. LFA-1 plays a central role in leukocyte intercellular adhesion through interactions with its ligands, ICAMs 1-3 (intercellular adhesion molecules 1 through 3), and also functions in lymphocyte costimulatory signaling. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Nullizygous mutations of this gene lead to increased leukocyte cell number, alter T cell activation, leukocyte migration and adhesion, spleen and lymph node morphology, and may affect humoral immune responses, metastatic potential, and susceptibility to endotoxin shock. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 67 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgrl2	T	A	3: 148,852,762	T437S	probably benign	Het
Akna	A	G	4: 63,379,333	F828S	probably benign	Het
Alg9	G	T	9: 50,775,502	A40S	possibly damaging	Het
Alox8	T	A	11: 69,185,241	H628L	possibly damaging	Het
Aox3	T	C	1: 58,152,554	W422R	probably benign	Het
Atp13a4	T	C	16: 29,409,710	D984G	probably benign	Het
Bcam	T	C	7: 19,760,382	E363G	possibly damaging	Het
Cadps2	C	A	6: 23,429,218	V519F	probably damaging	Het
Calca	A	G	7: 114,635,161	Y18H	probably damaging	Het
Cd70	A	G	17: 57,146,364	I100T	probably damaging	Het
Cdk4	T	A	10: 127,064,651	H95Q	probably damaging	Het
Chchd1	T	A	14: 20,703,342	N11K	probably damaging	Het
Cma2	T	A	14: 55,972,815	N52K	probably damaging	Het
Cyp3a16	A	G	5: 145,436,457	V500A	probably benign	Het
Dicer1	A	G	12: 104,721,969		probably null	Het
Dnajc13	A	G	9: 104,156,838	S2206P	probably benign	Het
Dtl	T	C	1: 191,561,546		probably null	Het
Fam186b	T	C	15: 99,286,971	T24A	probably benign	Het
Fbxw21	A	G	9: 109,161,916	V25A	probably benign	Het
Gins1	T	C	2: 150,912,838	S45P	probably benign	Het
Gtpbp2	T	A	17: 46,165,943	V349D	probably damaging	Het
Hyal5	G	T	6: 24,876,793	D222Y	probably damaging	Het
Klk14	A	G	7: 43,693,953		probably null	Het
Lama1	T	A	17: 67,810,409	L2518Q	possibly damaging	Het
Lrrc2	G	A	9: 110,979,487	G264D	probably benign	Het
Ltbp4	A	G	7: 27,322,820	S893P	probably damaging	Het
Mast4	G	A	13: 102,739,263	P1107L	probably damaging	Het
Mbd1	T	A	18: 74,275,419		probably null	Het
Naip2	A	T	13: 100,155,021	D1136E	probably benign	Het
Naip2	G	A	13: 100,155,029		probably benign	Het
Ncan	G	A	8: 70,110,198	T470I	probably benign	Het
Npy1r	A	T	8: 66,704,161	I78F	probably damaging	Het
Olfr1491	A	T	19: 13,705,525	M233L	probably benign	Het
Olfr917	G	A	9: 38,665,277	T189M	probably damaging	Het
Palb2	A	T	7: 122,110,838		probably null	Het
Pax3	T	C	1: 78,103,484	T422A	probably benign	Het
Pebp1	A	T	5: 117,286,164	D72E	possibly damaging	Het
Pnliprp1	A	T	19: 58,740,469	T363S	probably benign	Het
Rbm44	G	A	1: 91,156,843		probably null	Het
Rbm47	T	A	5: 66,025,015	Y425F	probably benign	Het
Robo3	G	T	9: 37,429,661	A83E	probably damaging	Het
Rrm1	A	G	7: 102,456,514	Y279C	probably damaging	Het
Rslcan18	A	T	13: 67,108,057		probably benign	Het
Scara5	C	A	14: 65,730,865	Q196K	probably benign	Het
Setd1b	C	T	5: 123,163,147		probably benign	Het
Siah1a	A	G	8: 86,725,241	F205S	probably damaging	Het
Smr2	AT	ATT	5: 88,108,824		probably null	Het
Ssu72	A	G	4: 155,731,357	D86G	probably benign	Het
St7	G	T	6: 17,886,111	K357N	probably damaging	Het
Sv2b	G	A	7: 75,147,677	T323I	probably damaging	Het
Syt1	T	C	10: 108,504,500	N319S	probably benign	Het
Tanc1	T	A	2: 59,791,651	F371L	probably damaging	Het
Tcf20	C	A	15: 82,855,492	G586V	probably benign	Het
Tg	T	C	15: 66,729,685		probably null	Het
Tyk2	A	T	9: 21,115,462	N620K	probably benign	Het
Ube2j1	T	A	4: 33,045,116	S130T	probably benign	Het
Ubr2	G	T	17: 46,932,492	P1696H	probably damaging	Het
Ubr5	A	T	15: 38,040,841	D266E	probably damaging	Het
Vipr2	A	G	12: 116,144,272	T426A	probably benign	Het
Vmn2r104	A	T	17: 20,042,215	W218R	probably damaging	Het
Vmn2r83	T	A	10: 79,479,122	N401K	probably damaging	Het
Vwf	A	G	6: 125,655,251	E82G	unknown	Het
Vwf	T	A	6: 125,663,571	Y2323*	probably null	Het
Wdr76	T	G	2: 121,528,921	V329G	probably damaging	Het
Zan	A	G	5: 137,461,952	C1226R	unknown	Het
Zbtb16	G	T	9: 48,832,272	Q247K	probably damaging	Het
Zfp541	T	C	7: 16,078,715	V431A	possibly damaging	Het

Other mutations in Itgal

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00987:Itgal	APN	7	127302011	missense	probably damaging	0.99
IGL01300:Itgal	APN	7	127314118	missense	probably damaging	1.00
IGL01345:Itgal	APN	7	127300956	missense	possibly damaging	0.56
IGL01826:Itgal	APN	7	127302146	missense	probably benign	0.16
IGL02202:Itgal	APN	7	127330179	nonsense	probably null
IGL02212:Itgal	APN	7	127300980	missense	probably benign	0.00
IGL02513:Itgal	APN	7	127328672	missense	possibly damaging	0.78
IGL02608:Itgal	APN	7	127310244	missense	probably damaging	1.00
IGL02946:Itgal	APN	7	127314368	missense	probably damaging	0.99
sunglow	UTSW	7	127328747	missense	probably null	0.89
R0069:Itgal	UTSW	7	127310331	missense	probably benign	0.44
R0069:Itgal	UTSW	7	127310331	missense	probably benign	0.44
R0107:Itgal	UTSW	7	127328559	splice site	probably benign
R0331:Itgal	UTSW	7	127306681	splice site	probably null
R0350:Itgal	UTSW	7	127322081	missense	probably damaging	1.00
R0380:Itgal	UTSW	7	127310751	nonsense	probably null
R0537:Itgal	UTSW	7	127311273	missense	possibly damaging	0.61
R0546:Itgal	UTSW	7	127310314	missense	probably benign	0.00
R0594:Itgal	UTSW	7	127314060	missense	probably damaging	1.00
R1167:Itgal	UTSW	7	127300939	missense	probably damaging	1.00
R1377:Itgal	UTSW	7	127321917	missense	probably damaging	1.00
R1690:Itgal	UTSW	7	127302117	missense	possibly damaging	0.56
R1693:Itgal	UTSW	7	127305281	missense	probably damaging	1.00
R1702:Itgal	UTSW	7	127305025	missense	probably benign	0.00
R1720:Itgal	UTSW	7	127306927	missense	probably benign	0.00
R1774:Itgal	UTSW	7	127309622	critical splice donor site	probably null
R1824:Itgal	UTSW	7	127314060	missense	probably damaging	1.00
R1878:Itgal	UTSW	7	127310671	missense	probably benign	0.44
R1951:Itgal	UTSW	7	127330145	missense	probably damaging	1.00
R2265:Itgal	UTSW	7	127306701	missense	possibly damaging	0.63
R2267:Itgal	UTSW	7	127306701	missense	possibly damaging	0.63
R2269:Itgal	UTSW	7	127306701	missense	possibly damaging	0.63
R2276:Itgal	UTSW	7	127328747	missense	probably null	0.89
R2570:Itgal	UTSW	7	127314096	missense	probably damaging	1.00
R3925:Itgal	UTSW	7	127324537	splice site	probably benign
R4225:Itgal	UTSW	7	127305312	missense	probably damaging	1.00
R4377:Itgal	UTSW	7	127328281	missense	probably benign	0.00
R4466:Itgal	UTSW	7	127328512	missense	possibly damaging	0.93
R4579:Itgal	UTSW	7	127305294	missense	possibly damaging	0.83
R4656:Itgal	UTSW	7	127322553	missense	probably damaging	1.00
R4771:Itgal	UTSW	7	127328233	missense	probably damaging	1.00
R5012:Itgal	UTSW	7	127299630	critical splice donor site	probably null
R5328:Itgal	UTSW	7	127311675	critical splice donor site	probably null
R5365:Itgal	UTSW	7	127305350	missense	probably damaging	0.98
R5579:Itgal	UTSW	7	127306929	missense	probably benign	0.10
R5849:Itgal	UTSW	7	127317320	missense	probably benign	0.27
R5955:Itgal	UTSW	7	127304989	missense	possibly damaging	0.82
R6254:Itgal	UTSW	7	127325203	missense	probably damaging	1.00
R6269:Itgal	UTSW	7	127330217	missense	probably null	1.00
R6520:Itgal	UTSW	7	127330331	missense	probably benign	0.01
R6541:Itgal	UTSW	7	127311562	missense	probably damaging	0.99
R7049:Itgal	UTSW	7	127296401	unclassified	probably benign
R7168:Itgal	UTSW	7	127330213	missense	probably benign
R7419:Itgal	UTSW	7	127306875	missense	probably benign	0.01
R7424:Itgal	UTSW	7	127317365	missense	probably benign	0.00
R7454:Itgal	UTSW	7	127327764	missense	probably benign	0.00
R7567:Itgal	UTSW	7	127299788	missense	probably benign	0.00
R7696:Itgal	UTSW	7	127330184	missense	probably damaging	1.00
R7977:Itgal	UTSW	7	127328298	missense	possibly damaging	0.88
R7987:Itgal	UTSW	7	127328298	missense	possibly damaging	0.88
R8118:Itgal	UTSW	7	127311245	missense	probably benign	0.08
R8297:Itgal	UTSW	7	127330466	missense	unknown
R8418:Itgal	UTSW	7	127330282	missense	probably benign	0.02
R8477:Itgal	UTSW	7	127300933	missense	probably damaging	1.00
R8507:Itgal	UTSW	7	127329435	missense	probably benign	0.26
R8789:Itgal	UTSW	7	127305249	missense	probably benign	0.05
R8838:Itgal	UTSW	7	127311261	missense	probably damaging	1.00
R8881:Itgal	UTSW	7	127330369	missense	probably benign	0.11
R8923:Itgal	UTSW	7	127296361	unclassified	probably benign
R9070:Itgal	UTSW	7	127328701	missense	probably null	0.98
R9104:Itgal	UTSW	7	127311622	missense	probably damaging	1.00
R9173:Itgal	UTSW	7	127297617	critical splice acceptor site	probably null
R9179:Itgal	UTSW	7	127306711	missense	probably benign	0.33
R9407:Itgal	UTSW	7	127322624	critical splice donor site	probably null
R9545:Itgal	UTSW	7	127330250	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGCCATTCCAAAGATGTGAGCATCC -3'
(R):5'- TGCAGAGGTGACATGCAAACCG -3'

Sequencing Primer
(F):5'- GCATCCATTGTTATAGAACGCTGG -3'
(R):5'- GGTCTGACTGATAAAAGCTTAGCC -3'

Posted On

2014-04-13