Mutagenetix > Incidental Mutation

Incidental Mutation 'R1575:Tyk2'

171105

Institutional Source

Beutler Lab

Gene Symbol

Tyk2

Ensembl Gene

ENSMUSG00000032175

Gene Name

tyrosine kinase 2

Synonyms

JTK1

MMRRC Submission

039613-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1575 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

21104068-21131243 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 21115462 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Lysine at position 620 (N620K)

Ref Sequence

ENSEMBL: ENSMUSP00000150214 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000001036] [ENSMUST00000214454] [ENSMUST00000216874]

AlphaFold

Q9R117

Predicted Effect

probably benign
Transcript: ENSMUST00000001036
AA Change: N643K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000001036
Gene: ENSMUSG00000032175
AA Change: N643K

Domain	Start	End	E-Value	Type
B41	29	301	1.51e-26	SMART
Blast:B41	408	460	3e-12	BLAST
SH2	470	562	1.26e-2	SMART
STYKc	612	886	8.89e-15	SMART
TyrKc	917	1189	6.48e-114	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000135674

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000213717

Predicted Effect

probably benign
Transcript: ENSMUST00000214454
AA Change: N620K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

Predicted Effect

probably benign
Transcript: ENSMUST00000216874
AA Change: N643K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.1%
3x: 98.2%
10x: 96.0%
20x: 91.5%

Validation Efficiency

100% (72/72)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the tyrosine kinase and, more specifically, the Janus kinases (JAKs) protein families. This protein associates with the cytoplasmic domain of type I and type II cytokine receptors and promulgate cytokine signals by phosphorylating receptor subunits. It is also component of both the type I and type III interferon signaling pathways. As such, it may play a role in anti-viral immunity. A mutation in this gene has been associated with hyperimmunoglobulin E syndrome (HIES) - a primary immunodeficiency characterized by elevated serum immunoglobulin E. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice are viable and fertile, but differ from wild-type with respect to interleukin 12 mediated T cell function. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 67 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgrl2	T	A	3: 148,852,762	T437S	probably benign	Het
Akna	A	G	4: 63,379,333	F828S	probably benign	Het
Alg9	G	T	9: 50,775,502	A40S	possibly damaging	Het
Alox8	T	A	11: 69,185,241	H628L	possibly damaging	Het
Aox3	T	C	1: 58,152,554	W422R	probably benign	Het
Atp13a4	T	C	16: 29,409,710	D984G	probably benign	Het
Bcam	T	C	7: 19,760,382	E363G	possibly damaging	Het
Cadps2	C	A	6: 23,429,218	V519F	probably damaging	Het
Calca	A	G	7: 114,635,161	Y18H	probably damaging	Het
Cd70	A	G	17: 57,146,364	I100T	probably damaging	Het
Cdk4	T	A	10: 127,064,651	H95Q	probably damaging	Het
Chchd1	T	A	14: 20,703,342	N11K	probably damaging	Het
Cma2	T	A	14: 55,972,815	N52K	probably damaging	Het
Cyp3a16	A	G	5: 145,436,457	V500A	probably benign	Het
Dicer1	A	G	12: 104,721,969		probably null	Het
Dnajc13	A	G	9: 104,156,838	S2206P	probably benign	Het
Dtl	T	C	1: 191,561,546		probably null	Het
Fam186b	T	C	15: 99,286,971	T24A	probably benign	Het
Fbxw21	A	G	9: 109,161,916	V25A	probably benign	Het
Gins1	T	C	2: 150,912,838	S45P	probably benign	Het
Gtpbp2	T	A	17: 46,165,943	V349D	probably damaging	Het
Hyal5	G	T	6: 24,876,793	D222Y	probably damaging	Het
Itgal	A	G	7: 127,300,888		probably null	Het
Klk14	A	G	7: 43,693,953		probably null	Het
Lama1	T	A	17: 67,810,409	L2518Q	possibly damaging	Het
Lrrc2	G	A	9: 110,979,487	G264D	probably benign	Het
Ltbp4	A	G	7: 27,322,820	S893P	probably damaging	Het
Mast4	G	A	13: 102,739,263	P1107L	probably damaging	Het
Mbd1	T	A	18: 74,275,419		probably null	Het
Naip2	A	T	13: 100,155,021	D1136E	probably benign	Het
Naip2	G	A	13: 100,155,029		probably benign	Het
Ncan	G	A	8: 70,110,198	T470I	probably benign	Het
Npy1r	A	T	8: 66,704,161	I78F	probably damaging	Het
Olfr1491	A	T	19: 13,705,525	M233L	probably benign	Het
Olfr917	G	A	9: 38,665,277	T189M	probably damaging	Het
Palb2	A	T	7: 122,110,838		probably null	Het
Pax3	T	C	1: 78,103,484	T422A	probably benign	Het
Pebp1	A	T	5: 117,286,164	D72E	possibly damaging	Het
Pnliprp1	A	T	19: 58,740,469	T363S	probably benign	Het
Rbm44	G	A	1: 91,156,843		probably null	Het
Rbm47	T	A	5: 66,025,015	Y425F	probably benign	Het
Robo3	G	T	9: 37,429,661	A83E	probably damaging	Het
Rrm1	A	G	7: 102,456,514	Y279C	probably damaging	Het
Rslcan18	A	T	13: 67,108,057		probably benign	Het
Scara5	C	A	14: 65,730,865	Q196K	probably benign	Het
Setd1b	C	T	5: 123,163,147		probably benign	Het
Siah1a	A	G	8: 86,725,241	F205S	probably damaging	Het
Smr2	AT	ATT	5: 88,108,824		probably null	Het
Ssu72	A	G	4: 155,731,357	D86G	probably benign	Het
St7	G	T	6: 17,886,111	K357N	probably damaging	Het
Sv2b	G	A	7: 75,147,677	T323I	probably damaging	Het
Syt1	T	C	10: 108,504,500	N319S	probably benign	Het
Tanc1	T	A	2: 59,791,651	F371L	probably damaging	Het
Tcf20	C	A	15: 82,855,492	G586V	probably benign	Het
Tg	T	C	15: 66,729,685		probably null	Het
Ube2j1	T	A	4: 33,045,116	S130T	probably benign	Het
Ubr2	G	T	17: 46,932,492	P1696H	probably damaging	Het
Ubr5	A	T	15: 38,040,841	D266E	probably damaging	Het
Vipr2	A	G	12: 116,144,272	T426A	probably benign	Het
Vmn2r104	A	T	17: 20,042,215	W218R	probably damaging	Het
Vmn2r83	T	A	10: 79,479,122	N401K	probably damaging	Het
Vwf	A	G	6: 125,655,251	E82G	unknown	Het
Vwf	T	A	6: 125,663,571	Y2323*	probably null	Het
Wdr76	T	G	2: 121,528,921	V329G	probably damaging	Het
Zan	A	G	5: 137,461,952	C1226R	unknown	Het
Zbtb16	G	T	9: 48,832,272	Q247K	probably damaging	Het
Zfp541	T	C	7: 16,078,715	V431A	possibly damaging	Het

Other mutations in Tyk2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00980:Tyk2	APN	9	21120588	missense	probably benign	0.27
IGL01015:Tyk2	APN	9	21120700	missense	probably benign	0.00
IGL01096:Tyk2	APN	9	21108863	missense	probably damaging	1.00
IGL01410:Tyk2	APN	9	21109364	missense	probably damaging	1.00
IGL01613:Tyk2	APN	9	21120576	missense	probably damaging	0.99
IGL01997:Tyk2	APN	9	21110494	missense	probably damaging	1.00
IGL02249:Tyk2	APN	9	21120407	missense	probably damaging	1.00
IGL02407:Tyk2	APN	9	21109227	splice site	probably benign
IGL02538:Tyk2	APN	9	21111043	missense	possibly damaging	0.94
IGL03185:Tyk2	APN	9	21109384	missense	probably damaging	1.00
conspiracy	UTSW	9	21108776	nonsense	probably null
fringe	UTSW	9	21108860	missense	probably benign	0.35
leonard	UTSW	9	21127120	splice site	probably benign
motorbike	UTSW	9	21105107	missense	probably damaging	1.00
tyke	UTSW	9	21124954	missense	probably damaging	1.00
ANU74:Tyk2	UTSW	9	21116158	missense	probably damaging	1.00
R0355:Tyk2	UTSW	9	21114190	splice site	probably null
R0667:Tyk2	UTSW	9	21108871	missense	probably damaging	1.00
R0862:Tyk2	UTSW	9	21116167	missense	probably benign	0.00
R0883:Tyk2	UTSW	9	21111137	missense	possibly damaging	0.61
R1554:Tyk2	UTSW	9	21107922	missense	probably damaging	0.96
R1664:Tyk2	UTSW	9	21120353	missense	probably damaging	1.00
R1676:Tyk2	UTSW	9	21115249	nonsense	probably null
R1843:Tyk2	UTSW	9	21121554	nonsense	probably null
R1871:Tyk2	UTSW	9	21121441	missense	probably damaging	1.00
R2044:Tyk2	UTSW	9	21120341	missense	probably damaging	1.00
R2137:Tyk2	UTSW	9	21110985	intron	probably benign
R2197:Tyk2	UTSW	9	21115207	missense	probably damaging	1.00
R2883:Tyk2	UTSW	9	21110587	missense	probably benign	0.01
R2941:Tyk2	UTSW	9	21111119	missense	probably benign	0.00
R3001:Tyk2	UTSW	9	21109321	missense	probably benign	0.00
R3002:Tyk2	UTSW	9	21109321	missense	probably benign	0.00
R3196:Tyk2	UTSW	9	21124032	missense	possibly damaging	0.80
R3622:Tyk2	UTSW	9	21127310	missense	probably damaging	0.98
R4024:Tyk2	UTSW	9	21115919	missense	probably damaging	1.00
R4459:Tyk2	UTSW	9	21124415	missense	probably damaging	1.00
R4604:Tyk2	UTSW	9	21108009	missense	probably damaging	1.00
R4664:Tyk2	UTSW	9	21114207	missense	probably damaging	0.99
R4666:Tyk2	UTSW	9	21114207	missense	probably damaging	0.99
R4915:Tyk2	UTSW	9	21111137	missense	probably benign	0.41
R4971:Tyk2	UTSW	9	21120501	critical splice donor site	probably null
R5014:Tyk2	UTSW	9	21115830	splice site	probably null
R5191:Tyk2	UTSW	9	21107497	missense	probably damaging	0.98
R5305:Tyk2	UTSW	9	21109381	missense	probably damaging	0.99
R5356:Tyk2	UTSW	9	21115744	missense	probably benign	0.03
R5501:Tyk2	UTSW	9	21121612	missense	probably damaging	1.00
R6025:Tyk2	UTSW	9	21115960	missense	probably benign	0.05
R6113:Tyk2	UTSW	9	21107922	missense	probably damaging	1.00
R6159:Tyk2	UTSW	9	21110504	missense	probably damaging	0.99
R6608:Tyk2	UTSW	9	21108016	missense	probably benign	0.02
R6610:Tyk2	UTSW	9	21108016	missense	probably benign	0.02
R6612:Tyk2	UTSW	9	21108016	missense	probably benign	0.02
R6870:Tyk2	UTSW	9	21124954	missense	probably damaging	1.00
R7216:Tyk2	UTSW	9	21120526	missense	probably benign	0.01
R7218:Tyk2	UTSW	9	21105054	missense	probably damaging	1.00
R7298:Tyk2	UTSW	9	21108860	missense	probably benign	0.35
R7322:Tyk2	UTSW	9	21110204	missense	probably benign
R7347:Tyk2	UTSW	9	21108034	missense	probably damaging	0.99
R7759:Tyk2	UTSW	9	21120258	critical splice donor site	probably null
R7840:Tyk2	UTSW	9	21124967	missense	probably damaging	1.00
R7854:Tyk2	UTSW	9	21115480	missense	probably benign
R7914:Tyk2	UTSW	9	21121555	missense	probably benign	0.01
R8312:Tyk2	UTSW	9	21115649	missense	possibly damaging	0.69
R8892:Tyk2	UTSW	9	21116167	missense	probably benign	0.00
R8934:Tyk2	UTSW	9	21127120	splice site	probably benign
R9013:Tyk2	UTSW	9	21105107	missense	probably damaging	1.00
R9091:Tyk2	UTSW	9	21124545	missense	probably damaging	1.00
R9097:Tyk2	UTSW	9	21108776	nonsense	probably null
R9104:Tyk2	UTSW	9	21115466	missense	possibly damaging	0.65
R9270:Tyk2	UTSW	9	21124545	missense	probably damaging	1.00
Z1177:Tyk2	UTSW	9	21105367	missense	probably benign
Z1177:Tyk2	UTSW	9	21108875	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGGGAACATGCAAACCCAGCTATG -3'
(R):5'- ACCAGGATGAAATCACCCAGGTGAG -3'

Sequencing Primer
(F):5'- ATGTGTGACACCTGGCTC -3'
(R):5'- CAAGGCACAAGGACCAATGT -3'

Posted On

2014-04-13