Mutagenetix > Incidental Mutations

Incidental Mutation 'R1575:Zbtb16'

171108

Institutional Source

Beutler Lab

Gene Symbol

Zbtb16

Ensembl Gene

ENSMUSG00000066687

Gene Name

zinc finger and BTB domain containing 16

Synonyms

Green's luxoid, Zfp145, PLZF

MMRRC Submission

039613-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.767) question?

Stock #

R1575 (G1)

Quality Score

192

Status

Validated

Chromosome

Chromosomal Location

48654297-48836222 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 48832272 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Lysine at position 247 (Q247K)

Ref Sequence

ENSEMBL: ENSMUSP00000150887 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000093852] [ENSMUST00000216150]

Predicted Effect

probably damaging
Transcript: ENSMUST00000093852
AA Change: Q247K

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000091374
Gene: ENSMUSG00000066687
AA Change: Q247K

Domain	Start	End	E-Value	Type
BTB	34	126	1.41e-24	SMART
ZnF_C2H2	404	426	3.72e0	SMART
ZnF_C2H2	432	454	8.22e-2	SMART
ZnF_C2H2	461	483	2.24e-3	SMART
ZnF_C2H2	490	512	1.56e-2	SMART
ZnF_C2H2	518	540	1.63e-5	SMART
ZnF_C2H2	546	568	1.95e-3	SMART
ZnF_C2H2	574	596	5.9e-3	SMART
ZnF_C2H2	602	624	2.36e-2	SMART
ZnF_C2H2	630	652	2.24e-3	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000216150
AA Change: Q247K

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)

Meta Mutation Damage Score

0.1087

Coding Region Coverage

1x: 99.1%
3x: 98.2%
10x: 96.0%
20x: 91.5%

Validation Efficiency

100% (72/72)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the Krueppel C2H2-type zinc-finger protein family and encodes a zinc finger transcription factor that contains nine Kruppel-type zinc finger domains at the carboxyl terminus. This protein is located in the nucleus, is involved in cell cycle progression, and interacts with a histone deacetylase. Specific instances of aberrant gene rearrangement at this locus have been associated with acute promyelocytic leukemia (APL). Alternate transcriptional splice variants have been characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutants exhibit abnormal anterior-posterior patterning, with skeletal abnormalities of the limb, especially the hindlimb, and homeotic transformations of anterior skeletal elements into posterior structures. Males develop infertility due to loss of germline cells with age. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 67 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgrl2	T	A	3: 148,852,762	T437S	probably benign	Het
Akna	A	G	4: 63,379,333	F828S	probably benign	Het
Alg9	G	T	9: 50,775,502	A40S	possibly damaging	Het
Alox8	T	A	11: 69,185,241	H628L	possibly damaging	Het
Aox3	T	C	1: 58,152,554	W422R	probably benign	Het
Atp13a4	T	C	16: 29,409,710	D984G	probably benign	Het
Bcam	T	C	7: 19,760,382	E363G	possibly damaging	Het
Cadps2	C	A	6: 23,429,218	V519F	probably damaging	Het
Calca	A	G	7: 114,635,161	Y18H	probably damaging	Het
Cd70	A	G	17: 57,146,364	I100T	probably damaging	Het
Cdk4	T	A	10: 127,064,651	H95Q	probably damaging	Het
Chchd1	T	A	14: 20,703,342	N11K	probably damaging	Het
Cma2	T	A	14: 55,972,815	N52K	probably damaging	Het
Cyp3a16	A	G	5: 145,436,457	V500A	probably benign	Het
Dicer1	A	G	12: 104,721,969		probably null	Het
Dnajc13	A	G	9: 104,156,838	S2206P	probably benign	Het
Dtl	T	C	1: 191,561,546		probably null	Het
Fam186b	T	C	15: 99,286,971	T24A	probably benign	Het
Fbxw21	A	G	9: 109,161,916	V25A	probably benign	Het
Gins1	T	C	2: 150,912,838	S45P	probably benign	Het
Gtpbp2	T	A	17: 46,165,943	V349D	probably damaging	Het
Hyal5	G	T	6: 24,876,793	D222Y	probably damaging	Het
Itgal	A	G	7: 127,300,888		probably null	Het
Klk14	A	G	7: 43,693,953		probably null	Het
Lama1	T	A	17: 67,810,409	L2518Q	possibly damaging	Het
Lrrc2	G	A	9: 110,979,487	G264D	probably benign	Het
Ltbp4	A	G	7: 27,322,820	S893P	probably damaging	Het
Mast4	G	A	13: 102,739,263	P1107L	probably damaging	Het
Mbd1	T	A	18: 74,275,419		probably null	Het
Naip2	A	T	13: 100,155,021	D1136E	probably benign	Het
Naip2	G	A	13: 100,155,029		probably benign	Het
Ncan	G	A	8: 70,110,198	T470I	probably benign	Het
Npy1r	A	T	8: 66,704,161	I78F	probably damaging	Het
Olfr1491	A	T	19: 13,705,525	M233L	probably benign	Het
Olfr917	G	A	9: 38,665,277	T189M	probably damaging	Het
Palb2	A	T	7: 122,110,838		probably null	Het
Pax3	T	C	1: 78,103,484	T422A	probably benign	Het
Pebp1	A	T	5: 117,286,164	D72E	possibly damaging	Het
Pnliprp1	A	T	19: 58,740,469	T363S	probably benign	Het
Rbm44	G	A	1: 91,156,843		probably null	Het
Rbm47	T	A	5: 66,025,015	Y425F	probably benign	Het
Robo3	G	T	9: 37,429,661	A83E	probably damaging	Het
Rrm1	A	G	7: 102,456,514	Y279C	probably damaging	Het
Rslcan18	A	T	13: 67,108,057		probably benign	Het
Scara5	C	A	14: 65,730,865	Q196K	probably benign	Het
Setd1b	C	T	5: 123,163,147		probably benign	Het
Siah1a	A	G	8: 86,725,241	F205S	probably damaging	Het
Smr2	AT	ATT	5: 88,108,824		probably null	Het
Ssu72	A	G	4: 155,731,357	D86G	probably benign	Het
St7	G	T	6: 17,886,111	K357N	probably damaging	Het
Sv2b	G	A	7: 75,147,677	T323I	probably damaging	Het
Syt1	T	C	10: 108,504,500	N319S	probably benign	Het
Tanc1	T	A	2: 59,791,651	F371L	probably damaging	Het
Tcf20	C	A	15: 82,855,492	G586V	probably benign	Het
Tg	T	C	15: 66,729,685		probably null	Het
Tyk2	A	T	9: 21,115,462	N620K	probably benign	Het
Ube2j1	T	A	4: 33,045,116	S130T	probably benign	Het
Ubr2	G	T	17: 46,932,492	P1696H	probably damaging	Het
Ubr5	A	T	15: 38,040,841	D266E	probably damaging	Het
Vipr2	A	G	12: 116,144,272	T426A	probably benign	Het
Vmn2r104	A	T	17: 20,042,215	W218R	probably damaging	Het
Vmn2r83	T	A	10: 79,479,122	N401K	probably damaging	Het
Vwf	A	G	6: 125,655,251	E82G	unknown	Het
Vwf	T	A	6: 125,663,571	Y2323*	probably null	Het
Wdr76	T	G	2: 121,528,921	V329G	probably damaging	Het
Zan	A	G	5: 137,461,952	C1226R	unknown	Het
Zfp541	T	C	7: 16,078,715	V431A	possibly damaging	Het

Other mutations in Zbtb16

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01977:Zbtb16	APN	9	48657183	missense	probably damaging	1.00
R0324:Zbtb16	UTSW	9	48665275	missense	possibly damaging	0.82
R0364:Zbtb16	UTSW	9	48743576	splice site	probably benign
R1538:Zbtb16	UTSW	9	48832283	missense	probably benign
R1937:Zbtb16	UTSW	9	48659778	missense	probably benign
R2656:Zbtb16	UTSW	9	48832688	missense	probably damaging	1.00
R4176:Zbtb16	UTSW	9	48659801	missense	probably damaging	1.00
R4582:Zbtb16	UTSW	9	48832082	missense	probably benign
R4595:Zbtb16	UTSW	9	48832080	missense	possibly damaging	0.79
R6466:Zbtb16	UTSW	9	48665319	missense	possibly damaging	0.95
R6966:Zbtb16	UTSW	9	48657354	missense	probably damaging	1.00
R7596:Zbtb16	UTSW	9	48832404	missense	possibly damaging	0.93
R7751:Zbtb16	UTSW	9	48743469	missense	probably damaging	1.00
R7904:Zbtb16	UTSW	9	48832972	missense	probably damaging	1.00
Z1176:Zbtb16	UTSW	9	48657288	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCCCATAATGCAGCTCTCTGGCAC -3'
(R):5'- CCGTAAGGCTCGATACCTCAAGAAC -3'

Sequencing Primer
(F):5'- ACTAGTGATGACACTGCCTCG -3'
(R):5'- TATCTCGAAGCATTCCAGCG -3'

Posted On

2014-04-13