Mutagenetix > Incidental Mutation

Incidental Mutation 'R1575:Dicer1'

171117

Institutional Source

Beutler Lab

Gene Symbol

Dicer1

Ensembl Gene

ENSMUSG00000041415

Gene Name

dicer 1, ribonuclease type III

Synonyms

D12Ertd7e

MMRRC Submission

039613-MU

Accession Numbers

Ncbi RefSeq: NM_148948.2; MGI:2177178

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R1575 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

104687742-104751952 bp(-) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

A to G at 104721969 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000043676 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000041987] [ENSMUST00000222002]

AlphaFold

no structure available at present

Predicted Effect

probably null
Transcript: ENSMUST00000041987

SMART Domains

Protein: ENSMUSP00000043676
Gene: ENSMUSG00000041415

Domain	Start	End	E-Value	Type
DEXDc	30	233	5.14e-24	SMART
low complexity region	403	419	N/A	INTRINSIC
HELICc	449	546	3.15e-10	SMART
Pfam:Dicer_dimer	620	707	1.4e-25	PFAM
low complexity region	713	723	N/A	INTRINSIC
PAZ	881	1056	1.67e-48	SMART
Blast:PAZ	1080	1129	2e-8	BLAST
RIBOc	1285	1582	1.83e-35	SMART
RIBOc	1665	1831	5.97e-49	SMART
DSRM	1834	1897	6.89e-9	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000221293

Predicted Effect

probably benign
Transcript: ENSMUST00000222002

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000222528

Meta Mutation Damage Score

0.9490

Coding Region Coverage

1x: 99.1%
3x: 98.2%
10x: 96.0%
20x: 91.5%

Validation Efficiency

100% (72/72)

MGI Phenotype

Strain: 3589209; 3809262; 2681012; 3576927
Lethality: E7-E14
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein possessing an RNA helicase motif containing a DEXH box in its amino terminus and an RNA motif in the carboxy terminus. The encoded protein functions as a ribonuclease and is required by the RNA interference and small temporal RNA (stRNA) pathways to produce the active small RNA component that represses gene expression. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2010]
PHENOTYPE: Mutation of this locus results in arrest of early embryonic development. [provided by MGI curators]

Allele List at MGI

All alleles(25) : Targeted(14) Gene trapped(11)

Other mutations in this stock

Total: 67 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgrl2	T	A	3: 148,852,762	T437S	probably benign	Het
Akna	A	G	4: 63,379,333	F828S	probably benign	Het
Alg9	G	T	9: 50,775,502	A40S	possibly damaging	Het
Alox8	T	A	11: 69,185,241	H628L	possibly damaging	Het
Aox3	T	C	1: 58,152,554	W422R	probably benign	Het
Atp13a4	T	C	16: 29,409,710	D984G	probably benign	Het
Bcam	T	C	7: 19,760,382	E363G	possibly damaging	Het
Cadps2	C	A	6: 23,429,218	V519F	probably damaging	Het
Calca	A	G	7: 114,635,161	Y18H	probably damaging	Het
Cd70	A	G	17: 57,146,364	I100T	probably damaging	Het
Cdk4	T	A	10: 127,064,651	H95Q	probably damaging	Het
Chchd1	T	A	14: 20,703,342	N11K	probably damaging	Het
Cma2	T	A	14: 55,972,815	N52K	probably damaging	Het
Cyp3a16	A	G	5: 145,436,457	V500A	probably benign	Het
Dnajc13	A	G	9: 104,156,838	S2206P	probably benign	Het
Dtl	T	C	1: 191,561,546		probably null	Het
Fam186b	T	C	15: 99,286,971	T24A	probably benign	Het
Fbxw21	A	G	9: 109,161,916	V25A	probably benign	Het
Gins1	T	C	2: 150,912,838	S45P	probably benign	Het
Gtpbp2	T	A	17: 46,165,943	V349D	probably damaging	Het
Hyal5	G	T	6: 24,876,793	D222Y	probably damaging	Het
Itgal	A	G	7: 127,300,888		probably null	Het
Klk14	A	G	7: 43,693,953		probably null	Het
Lama1	T	A	17: 67,810,409	L2518Q	possibly damaging	Het
Lrrc2	G	A	9: 110,979,487	G264D	probably benign	Het
Ltbp4	A	G	7: 27,322,820	S893P	probably damaging	Het
Mast4	G	A	13: 102,739,263	P1107L	probably damaging	Het
Mbd1	T	A	18: 74,275,419		probably null	Het
Naip2	A	T	13: 100,155,021	D1136E	probably benign	Het
Naip2	G	A	13: 100,155,029		probably benign	Het
Ncan	G	A	8: 70,110,198	T470I	probably benign	Het
Npy1r	A	T	8: 66,704,161	I78F	probably damaging	Het
Olfr1491	A	T	19: 13,705,525	M233L	probably benign	Het
Olfr917	G	A	9: 38,665,277	T189M	probably damaging	Het
Palb2	A	T	7: 122,110,838		probably null	Het
Pax3	T	C	1: 78,103,484	T422A	probably benign	Het
Pebp1	A	T	5: 117,286,164	D72E	possibly damaging	Het
Pnliprp1	A	T	19: 58,740,469	T363S	probably benign	Het
Rbm44	G	A	1: 91,156,843		probably null	Het
Rbm47	T	A	5: 66,025,015	Y425F	probably benign	Het
Robo3	G	T	9: 37,429,661	A83E	probably damaging	Het
Rrm1	A	G	7: 102,456,514	Y279C	probably damaging	Het
Rslcan18	A	T	13: 67,108,057		probably benign	Het
Scara5	C	A	14: 65,730,865	Q196K	probably benign	Het
Setd1b	C	T	5: 123,163,147		probably benign	Het
Siah1a	A	G	8: 86,725,241	F205S	probably damaging	Het
Smr2	AT	ATT	5: 88,108,824		probably null	Het
Ssu72	A	G	4: 155,731,357	D86G	probably benign	Het
St7	G	T	6: 17,886,111	K357N	probably damaging	Het
Sv2b	G	A	7: 75,147,677	T323I	probably damaging	Het
Syt1	T	C	10: 108,504,500	N319S	probably benign	Het
Tanc1	T	A	2: 59,791,651	F371L	probably damaging	Het
Tcf20	C	A	15: 82,855,492	G586V	probably benign	Het
Tg	T	C	15: 66,729,685		probably null	Het
Tyk2	A	T	9: 21,115,462	N620K	probably benign	Het
Ube2j1	T	A	4: 33,045,116	S130T	probably benign	Het
Ubr2	G	T	17: 46,932,492	P1696H	probably damaging	Het
Ubr5	A	T	15: 38,040,841	D266E	probably damaging	Het
Vipr2	A	G	12: 116,144,272	T426A	probably benign	Het
Vmn2r104	A	T	17: 20,042,215	W218R	probably damaging	Het
Vmn2r83	T	A	10: 79,479,122	N401K	probably damaging	Het
Vwf	T	A	6: 125,663,571	Y2323*	probably null	Het
Vwf	A	G	6: 125,655,251	E82G	unknown	Het
Wdr76	T	G	2: 121,528,921	V329G	probably damaging	Het
Zan	A	G	5: 137,461,952	C1226R	unknown	Het
Zbtb16	G	T	9: 48,832,272	Q247K	probably damaging	Het
Zfp541	T	C	7: 16,078,715	V431A	possibly damaging	Het

Other mutations in Dicer1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00943:Dicer1	APN	12	104696772	missense	possibly damaging	0.93
IGL01061:Dicer1	APN	12	104706327	missense	probably null	0.75
IGL01527:Dicer1	APN	12	104691610	nonsense	probably null
IGL01597:Dicer1	APN	12	104705210	nonsense	probably null
IGL01636:Dicer1	APN	12	104722241	missense	probably damaging	1.00
IGL01717:Dicer1	APN	12	104702787	nonsense	probably null
IGL01765:Dicer1	APN	12	104706740	missense	probably damaging	1.00
IGL01871:Dicer1	APN	12	104704180	missense	probably damaging	1.00
IGL02316:Dicer1	APN	12	104702553	missense	probably damaging	1.00
IGL02317:Dicer1	APN	12	104697020	missense	probably damaging	1.00
IGL02539:Dicer1	APN	12	104697035	missense	probably damaging	0.97
IGL02544:Dicer1	APN	12	104714832	missense	probably damaging	1.00
IGL02664:Dicer1	APN	12	104705129	missense	probably damaging	1.00
IGL02667:Dicer1	APN	12	104714906	missense	probably damaging	1.00
IGL03353:Dicer1	APN	12	104713107	missense	probably damaging	1.00
IGL03377:Dicer1	APN	12	104712197	missense	probably damaging	0.98
everest	UTSW	12	104705128	missense	probably damaging	1.00
PIT4480001:Dicer1	UTSW	12	104696544	missense	probably benign
R0032:Dicer1	UTSW	12	104704798	nonsense	probably null
R0032:Dicer1	UTSW	12	104704798	nonsense	probably null
R0219:Dicer1	UTSW	12	104692125	critical splice donor site	probably null
R0242:Dicer1	UTSW	12	104702451	missense	probably benign	0.02
R0242:Dicer1	UTSW	12	104702451	missense	probably benign	0.02
R0385:Dicer1	UTSW	12	104704174	missense	probably damaging	1.00
R0402:Dicer1	UTSW	12	104731064	missense	probably benign	0.04
R0426:Dicer1	UTSW	12	104702542	missense	probably damaging	1.00
R0453:Dicer1	UTSW	12	104702630	missense	probably benign
R0502:Dicer1	UTSW	12	104705060	missense	probably damaging	1.00
R0507:Dicer1	UTSW	12	104691658	missense	probably damaging	1.00
R0511:Dicer1	UTSW	12	104702841	missense	possibly damaging	0.95
R0523:Dicer1	UTSW	12	104702491	missense	probably damaging	1.00
R0559:Dicer1	UTSW	12	104706301	missense	probably damaging	1.00
R0600:Dicer1	UTSW	12	104706864	missense	probably damaging	1.00
R0707:Dicer1	UTSW	12	104706885	missense	probably damaging	1.00
R1225:Dicer1	UTSW	12	104691607	missense	probably damaging	0.98
R1351:Dicer1	UTSW	12	104729142	missense	probably damaging	0.99
R1449:Dicer1	UTSW	12	104729243	missense	possibly damaging	0.85
R1642:Dicer1	UTSW	12	104713156	missense	probably damaging	1.00
R1651:Dicer1	UTSW	12	104708805	missense	probably damaging	1.00
R1658:Dicer1	UTSW	12	104700414	missense	probably benign
R1815:Dicer1	UTSW	12	104722151	missense	probably damaging	1.00
R1816:Dicer1	UTSW	12	104722151	missense	probably damaging	1.00
R1927:Dicer1	UTSW	12	104702884	missense	possibly damaging	0.91
R2113:Dicer1	UTSW	12	104713214	missense	probably damaging	1.00
R2129:Dicer1	UTSW	12	104722031	missense	probably damaging	1.00
R2157:Dicer1	UTSW	12	104702949	missense	probably benign	0.17
R2202:Dicer1	UTSW	12	104731038	missense	possibly damaging	0.95
R2203:Dicer1	UTSW	12	104731038	missense	possibly damaging	0.95
R2243:Dicer1	UTSW	12	104730188	missense	probably damaging	0.99
R4237:Dicer1	UTSW	12	104729228	missense	possibly damaging	0.48
R4419:Dicer1	UTSW	12	104705114	missense	probably damaging	1.00
R4482:Dicer1	UTSW	12	104706277	missense	probably damaging	1.00
R4564:Dicer1	UTSW	12	104704751	nonsense	probably null
R4776:Dicer1	UTSW	12	104692446	missense	probably damaging	0.99
R4834:Dicer1	UTSW	12	104696591	missense	probably benign	0.44
R4904:Dicer1	UTSW	12	104713066	missense	probably benign
R5202:Dicer1	UTSW	12	104694731	nonsense	probably null
R5272:Dicer1	UTSW	12	104704240	missense	probably damaging	1.00
R5363:Dicer1	UTSW	12	104703151	missense	probably damaging	1.00
R5717:Dicer1	UTSW	12	104705128	missense	probably damaging	1.00
R6381:Dicer1	UTSW	12	104696462	missense	probably benign	0.00
R6479:Dicer1	UTSW	12	104696723	missense	probably damaging	0.97
R6956:Dicer1	UTSW	12	104731023	missense	probably damaging	1.00
R7234:Dicer1	UTSW	12	104708849	missense	probably damaging	1.00
R7401:Dicer1	UTSW	12	104712278	missense	probably benign
R7407:Dicer1	UTSW	12	104722351	nonsense	probably null
R7471:Dicer1	UTSW	12	104694710	missense	probably damaging	1.00
R7699:Dicer1	UTSW	12	104705170	missense	probably damaging	1.00
R7768:Dicer1	UTSW	12	104706697	missense	probably damaging	0.99
R7831:Dicer1	UTSW	12	104708800	missense	probably damaging	1.00
R7998:Dicer1	UTSW	12	104704069	missense	probably damaging	1.00
R8010:Dicer1	UTSW	12	104692132	missense	probably damaging	0.99
R8061:Dicer1	UTSW	12	104702818	nonsense	probably null
R8213:Dicer1	UTSW	12	104702693	missense	probably benign	0.00
R8261:Dicer1	UTSW	12	104691606	missense	probably damaging	1.00
R8419:Dicer1	UTSW	12	104702677	missense	probably benign	0.00
R8708:Dicer1	UTSW	12	104728445	missense	possibly damaging	0.65
R8851:Dicer1	UTSW	12	104724041	missense	possibly damaging	0.76
R9220:Dicer1	UTSW	12	104713156	missense	probably damaging	1.00
R9371:Dicer1	UTSW	12	104704732	missense	probably damaging	1.00
R9387:Dicer1	UTSW	12	104729240	missense	possibly damaging	0.48
R9505:Dicer1	UTSW	12	104731038	missense	possibly damaging	0.95
R9636:Dicer1	UTSW	12	104722147	nonsense	probably null
R9682:Dicer1	UTSW	12	104706225	missense	probably damaging	1.00
X0018:Dicer1	UTSW	12	104696934	missense	probably benign	0.00
Z1176:Dicer1	UTSW	12	104731020	missense	probably null	0.97

Predicted Primers

PCR Primer
(F):5'- GCTGTGAGAGATGACTCCAGCAAC -3'
(R):5'- CCTGCCTCACTTGACCTGAAGTATG -3'

Sequencing Primer
(F):5'- GCATACAAACAAGGAATGCTTTGC -3'
(R):5'- CCTATGAGCGACAGCAGTTTG -3'

Posted On

2014-04-13