Incidental Mutation 'R1575:Rslcan18'
ID 171119
Institutional Source Beutler Lab
Gene Symbol Rslcan18
Ensembl Gene ENSMUSG00000074824
Gene Name regulator of sex-limitation candidate 18
Synonyms
MMRRC Submission 039613-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.128) question?
Stock # R1575 (G1)
Quality Score 225
Status Validated
Chromosome 13
Chromosomal Location 67096613-67116263 bp(-) (GRCm38)
Type of Mutation intron
DNA Base Change (assembly) A to T at 67108057 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000140296 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091526] [ENSMUST00000186303]
AlphaFold Q7M6X5
Predicted Effect probably benign
Transcript: ENSMUST00000091526
SMART Domains Protein: ENSMUSP00000089111
Gene: ENSMUSG00000074824

DomainStartEndE-ValueType
KRAB 96 156 5.31e-28 SMART
ZnF_C2H2 171 193 4.24e-4 SMART
ZnF_C2H2 199 221 1.56e-2 SMART
ZnF_C2H2 227 249 1.82e-3 SMART
ZnF_C2H2 255 277 1.82e-3 SMART
ZnF_C2H2 283 305 3.26e-5 SMART
ZnF_C2H2 311 333 1.82e-3 SMART
ZnF_C2H2 339 361 1.26e-2 SMART
ZnF_C2H2 367 389 2.12e-4 SMART
ZnF_C2H2 395 417 4.87e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000186303
SMART Domains Protein: ENSMUSP00000140296
Gene: ENSMUSG00000100235

DomainStartEndE-ValueType
KRAB 1 32 9.7e-3 SMART
ZnF_C2H2 47 69 1.8e-6 SMART
ZnF_C2H2 75 97 6.7e-5 SMART
ZnF_C2H2 103 125 7.6e-6 SMART
ZnF_C2H2 131 153 7.6e-6 SMART
ZnF_C2H2 159 181 1.4e-7 SMART
ZnF_C2H2 187 209 7.6e-6 SMART
ZnF_C2H2 215 237 5.5e-5 SMART
ZnF_C2H2 243 265 8.9e-7 SMART
ZnF_C2H2 271 293 2e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187652
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189620
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225558
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.5%
Validation Efficiency 100% (72/72)
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrl2 T A 3: 148,852,762 T437S probably benign Het
Akna A G 4: 63,379,333 F828S probably benign Het
Alg9 G T 9: 50,775,502 A40S possibly damaging Het
Alox8 T A 11: 69,185,241 H628L possibly damaging Het
Aox3 T C 1: 58,152,554 W422R probably benign Het
Atp13a4 T C 16: 29,409,710 D984G probably benign Het
Bcam T C 7: 19,760,382 E363G possibly damaging Het
Cadps2 C A 6: 23,429,218 V519F probably damaging Het
Calca A G 7: 114,635,161 Y18H probably damaging Het
Cd70 A G 17: 57,146,364 I100T probably damaging Het
Cdk4 T A 10: 127,064,651 H95Q probably damaging Het
Chchd1 T A 14: 20,703,342 N11K probably damaging Het
Cma2 T A 14: 55,972,815 N52K probably damaging Het
Cyp3a16 A G 5: 145,436,457 V500A probably benign Het
Dicer1 A G 12: 104,721,969 probably null Het
Dnajc13 A G 9: 104,156,838 S2206P probably benign Het
Dtl T C 1: 191,561,546 probably null Het
Fam186b T C 15: 99,286,971 T24A probably benign Het
Fbxw21 A G 9: 109,161,916 V25A probably benign Het
Gins1 T C 2: 150,912,838 S45P probably benign Het
Gtpbp2 T A 17: 46,165,943 V349D probably damaging Het
Hyal5 G T 6: 24,876,793 D222Y probably damaging Het
Itgal A G 7: 127,300,888 probably null Het
Klk14 A G 7: 43,693,953 probably null Het
Lama1 T A 17: 67,810,409 L2518Q possibly damaging Het
Lrrc2 G A 9: 110,979,487 G264D probably benign Het
Ltbp4 A G 7: 27,322,820 S893P probably damaging Het
Mast4 G A 13: 102,739,263 P1107L probably damaging Het
Mbd1 T A 18: 74,275,419 probably null Het
Naip2 A T 13: 100,155,021 D1136E probably benign Het
Naip2 G A 13: 100,155,029 probably benign Het
Ncan G A 8: 70,110,198 T470I probably benign Het
Npy1r A T 8: 66,704,161 I78F probably damaging Het
Olfr1491 A T 19: 13,705,525 M233L probably benign Het
Olfr917 G A 9: 38,665,277 T189M probably damaging Het
Palb2 A T 7: 122,110,838 probably null Het
Pax3 T C 1: 78,103,484 T422A probably benign Het
Pebp1 A T 5: 117,286,164 D72E possibly damaging Het
Pnliprp1 A T 19: 58,740,469 T363S probably benign Het
Rbm44 G A 1: 91,156,843 probably null Het
Rbm47 T A 5: 66,025,015 Y425F probably benign Het
Robo3 G T 9: 37,429,661 A83E probably damaging Het
Rrm1 A G 7: 102,456,514 Y279C probably damaging Het
Scara5 C A 14: 65,730,865 Q196K probably benign Het
Setd1b C T 5: 123,163,147 probably benign Het
Siah1a A G 8: 86,725,241 F205S probably damaging Het
Smr2 AT ATT 5: 88,108,824 probably null Het
Ssu72 A G 4: 155,731,357 D86G probably benign Het
St7 G T 6: 17,886,111 K357N probably damaging Het
Sv2b G A 7: 75,147,677 T323I probably damaging Het
Syt1 T C 10: 108,504,500 N319S probably benign Het
Tanc1 T A 2: 59,791,651 F371L probably damaging Het
Tcf20 C A 15: 82,855,492 G586V probably benign Het
Tg T C 15: 66,729,685 probably null Het
Tyk2 A T 9: 21,115,462 N620K probably benign Het
Ube2j1 T A 4: 33,045,116 S130T probably benign Het
Ubr2 G T 17: 46,932,492 P1696H probably damaging Het
Ubr5 A T 15: 38,040,841 D266E probably damaging Het
Vipr2 A G 12: 116,144,272 T426A probably benign Het
Vmn2r104 A T 17: 20,042,215 W218R probably damaging Het
Vmn2r83 T A 10: 79,479,122 N401K probably damaging Het
Vwf A G 6: 125,655,251 E82G unknown Het
Vwf T A 6: 125,663,571 Y2323* probably null Het
Wdr76 T G 2: 121,528,921 V329G probably damaging Het
Zan A G 5: 137,461,952 C1226R unknown Het
Zbtb16 G T 9: 48,832,272 Q247K probably damaging Het
Zfp541 T C 7: 16,078,715 V431A possibly damaging Het
Other mutations in Rslcan18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01520:Rslcan18 APN 13 67102108 missense probably benign 0.01
IGL01760:Rslcan18 APN 13 67113951 missense probably benign 0.04
R0003:Rslcan18 UTSW 13 67098469 missense probably benign 0.01
R0333:Rslcan18 UTSW 13 67098622 missense probably damaging 0.99
R0505:Rslcan18 UTSW 13 67102119 missense probably benign 0.31
R0525:Rslcan18 UTSW 13 67112258 missense probably benign 0.03
R0898:Rslcan18 UTSW 13 67098816 missense probably benign 0.02
R1449:Rslcan18 UTSW 13 67102100 missense possibly damaging 0.65
R1511:Rslcan18 UTSW 13 67098952 missense possibly damaging 0.94
R1973:Rslcan18 UTSW 13 67108023 intron probably benign
R3109:Rslcan18 UTSW 13 67098607 missense possibly damaging 0.53
R4707:Rslcan18 UTSW 13 67098526 missense probably damaging 1.00
R5277:Rslcan18 UTSW 13 67098434 missense probably benign 0.03
R8887:Rslcan18 UTSW 13 67098729 missense probably damaging 1.00
R9472:Rslcan18 UTSW 13 67112232 missense probably benign 0.11
R9475:Rslcan18 UTSW 13 67102064 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGGAAGTCACAAGAACTCTCGCAC -3'
(R):5'- GCCATCAGTCTACTGCTGCTTCAG -3'

Sequencing Primer
(F):5'- AGAACTCTCGCACCTCCTG -3'
(R):5'- TGCTTCCCACATGGTGGAAAG -3'
Posted On 2014-04-13