Incidental Mutation 'R1575:Ubr5'
ID171126
Institutional Source Beutler Lab
Gene Symbol Ubr5
Ensembl Gene ENSMUSG00000037487
Gene Nameubiquitin protein ligase E3 component n-recognin 5
SynonymsEdd, 4432411E13Rik, Edd1
MMRRC Submission 039613-MU
Accession Numbers

NCBI RefSeq: NM_001081359.2, NM_001112721.1; MGI:1918040

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1575 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location37967328-38078854 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 38040841 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 266 (D266E)
Ref Sequence ENSEMBL: ENSMUSP00000154293 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110336] [ENSMUST00000226414]
Predicted Effect probably damaging
Transcript: ENSMUST00000110336
AA Change: D266E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000105965
Gene: ENSMUSG00000037487
AA Change: D266E

DomainStartEndE-ValueType
low complexity region 94 111 N/A INTRINSIC
low complexity region 129 156 N/A INTRINSIC
Pfam:E3_UbLigase_EDD 179 230 9.7e-35 PFAM
low complexity region 282 323 N/A INTRINSIC
low complexity region 614 628 N/A INTRINSIC
low complexity region 860 870 N/A INTRINSIC
low complexity region 933 950 N/A INTRINSIC
low complexity region 970 999 N/A INTRINSIC
low complexity region 1140 1151 N/A INTRINSIC
ZnF_UBR1 1177 1244 5.42e-27 SMART
low complexity region 1396 1405 N/A INTRINSIC
low complexity region 1524 1537 N/A INTRINSIC
low complexity region 1567 1613 N/A INTRINSIC
low complexity region 1641 1657 N/A INTRINSIC
low complexity region 1662 1687 N/A INTRINSIC
low complexity region 1726 1742 N/A INTRINSIC
low complexity region 1759 1789 N/A INTRINSIC
low complexity region 1879 1890 N/A INTRINSIC
low complexity region 1972 1983 N/A INTRINSIC
low complexity region 1986 1997 N/A INTRINSIC
Blast:HECTc 2271 2313 2e-6 BLAST
low complexity region 2329 2366 N/A INTRINSIC
PolyA 2389 2452 3.97e-33 SMART
HECTc 2432 2798 1e-151 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000226414
AA Change: D266E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Meta Mutation Damage Score 0.7562 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.5%
Validation Efficiency 100% (72/72)
MGI Phenotype Strain: 3052764
Lethality: E11-E12
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a progestin-induced protein, which belongs to the HECT (homology to E6-AP carboxyl terminus) family. The HECT family proteins function as E3 ubiquitin-protein ligases, targeting specific proteins for ubiquitin-mediated proteolysis. This gene is localized to chromosome 8q22 which is disrupted in a variety of cancers. This gene potentially has a role in regulation of cell proliferation or differentiation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display embryonic lethality during organogenesis, impaired growth of the allantois, failure or impairment of chorioallantoic fusion, impaired angiogenesis in the yolk sac and allantois, decreased cell proliferation, and increased apoptosis. [provided by MGI curators]
Allele List at MGI

All alleles(151) : Targeted(3) Gene trapped(148)

Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrl2 T A 3: 148,852,762 T437S probably benign Het
Akna A G 4: 63,379,333 F828S probably benign Het
Alg9 G T 9: 50,775,502 A40S possibly damaging Het
Alox8 T A 11: 69,185,241 H628L possibly damaging Het
Aox3 T C 1: 58,152,554 W422R probably benign Het
Atp13a4 T C 16: 29,409,710 D984G probably benign Het
Bcam T C 7: 19,760,382 E363G possibly damaging Het
Cadps2 C A 6: 23,429,218 V519F probably damaging Het
Calca A G 7: 114,635,161 Y18H probably damaging Het
Cd70 A G 17: 57,146,364 I100T probably damaging Het
Cdk4 T A 10: 127,064,651 H95Q probably damaging Het
Chchd1 T A 14: 20,703,342 N11K probably damaging Het
Cma2 T A 14: 55,972,815 N52K probably damaging Het
Cyp3a16 A G 5: 145,436,457 V500A probably benign Het
Dicer1 A G 12: 104,721,969 probably null Het
Dnajc13 A G 9: 104,156,838 S2206P probably benign Het
Dtl T C 1: 191,561,546 probably null Het
Fam186b T C 15: 99,286,971 T24A probably benign Het
Fbxw21 A G 9: 109,161,916 V25A probably benign Het
Gins1 T C 2: 150,912,838 S45P probably benign Het
Gtpbp2 T A 17: 46,165,943 V349D probably damaging Het
Hyal5 G T 6: 24,876,793 D222Y probably damaging Het
Itgal A G 7: 127,300,888 probably null Het
Klk14 A G 7: 43,693,953 probably null Het
Lama1 T A 17: 67,810,409 L2518Q possibly damaging Het
Lrrc2 G A 9: 110,979,487 G264D probably benign Het
Ltbp4 A G 7: 27,322,820 S893P probably damaging Het
Mast4 G A 13: 102,739,263 P1107L probably damaging Het
Mbd1 T A 18: 74,275,419 probably null Het
Naip2 A T 13: 100,155,021 D1136E probably benign Het
Naip2 G A 13: 100,155,029 probably benign Het
Ncan G A 8: 70,110,198 T470I probably benign Het
Npy1r A T 8: 66,704,161 I78F probably damaging Het
Olfr1491 A T 19: 13,705,525 M233L probably benign Het
Olfr917 G A 9: 38,665,277 T189M probably damaging Het
Palb2 A T 7: 122,110,838 probably null Het
Pax3 T C 1: 78,103,484 T422A probably benign Het
Pebp1 A T 5: 117,286,164 D72E possibly damaging Het
Pnliprp1 A T 19: 58,740,469 T363S probably benign Het
Rbm44 G A 1: 91,156,843 probably null Het
Rbm47 T A 5: 66,025,015 Y425F probably benign Het
Robo3 G T 9: 37,429,661 A83E probably damaging Het
Rrm1 A G 7: 102,456,514 Y279C probably damaging Het
Rslcan18 A T 13: 67,108,057 probably benign Het
Scara5 C A 14: 65,730,865 Q196K probably benign Het
Setd1b C T 5: 123,163,147 probably benign Het
Siah1a A G 8: 86,725,241 F205S probably damaging Het
Smr2 AT ATT 5: 88,108,824 probably null Het
Ssu72 A G 4: 155,731,357 D86G probably benign Het
St7 G T 6: 17,886,111 K357N probably damaging Het
Sv2b G A 7: 75,147,677 T323I probably damaging Het
Syt1 T C 10: 108,504,500 N319S probably benign Het
Tanc1 T A 2: 59,791,651 F371L probably damaging Het
Tcf20 C A 15: 82,855,492 G586V probably benign Het
Tg T C 15: 66,729,685 probably null Het
Tyk2 A T 9: 21,115,462 N620K probably benign Het
Ube2j1 T A 4: 33,045,116 S130T probably benign Het
Ubr2 G T 17: 46,932,492 P1696H probably damaging Het
Vipr2 A G 12: 116,144,272 T426A probably benign Het
Vmn2r104 A T 17: 20,042,215 W218R probably damaging Het
Vmn2r83 T A 10: 79,479,122 N401K probably damaging Het
Vwf A G 6: 125,655,251 E82G unknown Het
Vwf T A 6: 125,663,571 Y2323* probably null Het
Wdr76 T G 2: 121,528,921 V329G probably damaging Het
Zan A G 5: 137,461,952 C1226R unknown Het
Zbtb16 G T 9: 48,832,272 Q247K probably damaging Het
Zfp541 T C 7: 16,078,715 V431A possibly damaging Het
Other mutations in Ubr5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Ubr5 APN 15 37984036 missense probably damaging 1.00
IGL00548:Ubr5 APN 15 38004321 missense probably benign 0.11
IGL00675:Ubr5 APN 15 38018284 missense possibly damaging 0.84
IGL00770:Ubr5 APN 15 38006541 missense probably benign 0.27
IGL00774:Ubr5 APN 15 38006541 missense probably benign 0.27
IGL00919:Ubr5 APN 15 38040842 missense probably damaging 1.00
IGL00962:Ubr5 APN 15 37985934 missense probably damaging 1.00
IGL01328:Ubr5 APN 15 37981523 missense possibly damaging 0.82
IGL01359:Ubr5 APN 15 37973006 missense probably damaging 0.96
IGL01394:Ubr5 APN 15 38009631 missense possibly damaging 0.90
IGL01674:Ubr5 APN 15 37998379 missense probably damaging 1.00
IGL01981:Ubr5 APN 15 37996598 missense probably benign 0.08
IGL01993:Ubr5 APN 15 37973012 missense probably damaging 0.99
IGL02159:Ubr5 APN 15 37991379 splice site probably benign
IGL02252:Ubr5 APN 15 38024894 missense probably damaging 1.00
IGL02442:Ubr5 APN 15 38037901 missense possibly damaging 0.95
IGL02502:Ubr5 APN 15 38030689 missense probably benign 0.01
IGL02503:Ubr5 APN 15 38018320 missense possibly damaging 0.90
IGL02503:Ubr5 APN 15 38018314 missense probably damaging 0.99
IGL02546:Ubr5 APN 15 38008747 missense probably benign 0.00
IGL02556:Ubr5 APN 15 38002448 missense probably benign 0.18
IGL02647:Ubr5 APN 15 37992082 missense probably damaging 0.99
IGL02679:Ubr5 APN 15 38002314 missense probably benign 0.36
IGL02726:Ubr5 APN 15 38000562 splice site probably benign
IGL02884:Ubr5 APN 15 37998376 missense probably damaging 1.00
IGL02972:Ubr5 APN 15 38041952 missense probably damaging 1.00
IGL03000:Ubr5 APN 15 38024852 missense probably damaging 0.99
IGL03028:Ubr5 APN 15 38047593 missense probably benign 0.00
IGL03057:Ubr5 APN 15 38040906 splice site probably benign
IGL03085:Ubr5 APN 15 38029568 missense probably damaging 1.00
IGL03198:Ubr5 APN 15 38045720 missense probably damaging 1.00
IGL03368:Ubr5 APN 15 37998316 missense probably damaging 0.96
P0016:Ubr5 UTSW 15 38000578 missense probably damaging 1.00
PIT4142001:Ubr5 UTSW 15 38041909 missense probably damaging 0.98
R0133:Ubr5 UTSW 15 37996571 missense probably damaging 0.98
R0173:Ubr5 UTSW 15 38004675 missense probably damaging 1.00
R0234:Ubr5 UTSW 15 37968493 missense probably damaging 1.00
R0234:Ubr5 UTSW 15 37968493 missense probably damaging 1.00
R0314:Ubr5 UTSW 15 37997187 missense probably damaging 0.99
R0379:Ubr5 UTSW 15 38018957 missense probably benign 0.00
R0390:Ubr5 UTSW 15 38030672 missense probably benign 0.19
R0415:Ubr5 UTSW 15 37972980 missense probably damaging 0.98
R0531:Ubr5 UTSW 15 37991344 missense probably benign 0.34
R0650:Ubr5 UTSW 15 38030807 splice site probably benign
R0720:Ubr5 UTSW 15 37972991 missense probably damaging 0.98
R1183:Ubr5 UTSW 15 37997175 missense possibly damaging 0.71
R1302:Ubr5 UTSW 15 38041479 missense possibly damaging 0.91
R1442:Ubr5 UTSW 15 38014924 splice site probably benign
R1507:Ubr5 UTSW 15 37980870 missense probably damaging 1.00
R1577:Ubr5 UTSW 15 38030730 missense possibly damaging 0.76
R1622:Ubr5 UTSW 15 38009113 unclassified probably benign
R1721:Ubr5 UTSW 15 38041846 missense probably benign 0.18
R1799:Ubr5 UTSW 15 37989377 missense probably damaging 1.00
R1840:Ubr5 UTSW 15 37980917 missense possibly damaging 0.51
R1867:Ubr5 UTSW 15 38041846 missense probably benign 0.18
R1868:Ubr5 UTSW 15 38041846 missense probably benign 0.18
R2065:Ubr5 UTSW 15 38040842 missense probably damaging 1.00
R2107:Ubr5 UTSW 15 37989302 missense probably benign 0.00
R2201:Ubr5 UTSW 15 38002299 missense possibly damaging 0.83
R2261:Ubr5 UTSW 15 37988284 missense probably damaging 0.99
R2441:Ubr5 UTSW 15 37989345 missense probably damaging 0.99
R2512:Ubr5 UTSW 15 38002319 missense probably damaging 1.00
R3008:Ubr5 UTSW 15 38030845 missense probably benign
R3412:Ubr5 UTSW 15 38004235 splice site probably benign
R3898:Ubr5 UTSW 15 37997739 missense probably benign 0.02
R3900:Ubr5 UTSW 15 38019242 missense probably damaging 1.00
R4032:Ubr5 UTSW 15 38024837 missense probably benign 0.22
R4352:Ubr5 UTSW 15 38041573 missense probably benign 0.31
R4362:Ubr5 UTSW 15 38078403 missense probably damaging 0.99
R4467:Ubr5 UTSW 15 38004336 missense probably damaging 1.00
R4507:Ubr5 UTSW 15 38013542 missense probably damaging 0.96
R4683:Ubr5 UTSW 15 38037967 missense probably damaging 1.00
R4771:Ubr5 UTSW 15 38018297 missense possibly damaging 0.50
R4878:Ubr5 UTSW 15 38006564 missense probably benign 0.01
R4999:Ubr5 UTSW 15 38009668 missense probably benign 0.06
R5057:Ubr5 UTSW 15 38004109 missense probably damaging 0.98
R5177:Ubr5 UTSW 15 38006517 missense probably benign 0.22
R5186:Ubr5 UTSW 15 37997916 missense probably damaging 0.99
R5378:Ubr5 UTSW 15 37989578 missense probably damaging 1.00
R5486:Ubr5 UTSW 15 38008739 missense probably benign 0.00
R5494:Ubr5 UTSW 15 38019281 missense possibly damaging 0.78
R5617:Ubr5 UTSW 15 38030657 missense possibly damaging 0.47
R5636:Ubr5 UTSW 15 37983996 missense probably damaging 1.00
R5655:Ubr5 UTSW 15 38015093 missense probably damaging 0.99
R5715:Ubr5 UTSW 15 38002233 missense probably benign 0.06
R5781:Ubr5 UTSW 15 38006541 missense probably benign 0.27
R6645:Ubr5 UTSW 15 38029506 missense probably damaging 1.00
R6774:Ubr5 UTSW 15 38015135 missense probably damaging 1.00
R6823:Ubr5 UTSW 15 37989598 missense probably benign 0.08
R6877:Ubr5 UTSW 15 38002570 missense probably damaging 0.98
R7105:Ubr5 UTSW 15 38008775 missense
R7166:Ubr5 UTSW 15 37976145 missense
R7514:Ubr5 UTSW 15 37988237 missense
R7523:Ubr5 UTSW 15 38004055 missense
R7631:Ubr5 UTSW 15 38029507 missense
R7709:Ubr5 UTSW 15 37979832 missense probably null
R7710:Ubr5 UTSW 15 37979832 missense probably null
R7712:Ubr5 UTSW 15 37979832 missense probably null
R7803:Ubr5 UTSW 15 37979832 missense probably null
R7816:Ubr5 UTSW 15 37979832 missense probably null
R7817:Ubr5 UTSW 15 37979832 missense probably null
R7821:Ubr5 UTSW 15 37997187 missense probably damaging 0.96
R7824:Ubr5 UTSW 15 37991322 missense probably damaging 0.97
RF024:Ubr5 UTSW 15 38028652 missense
X0024:Ubr5 UTSW 15 37992060 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGGCTATGTAATGACTTCGCCCTAC -3'
(R):5'- AGCAGTTATGCAGACTGTTCGTCC -3'

Sequencing Primer
(F):5'- GACTTCGCCCTACTGTAAGATCTAAG -3'
(R):5'- CTTAGATCTTGGGGGACACTC -3'
Posted On2014-04-13