Incidental Mutation 'R1575:Ubr2'
ID 171133
Institutional Source Beutler Lab
Gene Symbol Ubr2
Ensembl Gene ENSMUSG00000023977
Gene Name ubiquitin protein ligase E3 component n-recognin 2
Synonyms 9930021A08Rik, E130209G04Rik, ENSMUSG00000043296
MMRRC Submission 039613-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.910) question?
Stock # R1575 (G1)
Quality Score 225
Status Validated
Chromosome 17
Chromosomal Location 46928295-47010556 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 46932492 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Proline to Histidine at position 1696 (P1696H)
Ref Sequence ENSEMBL: ENSMUSP00000108963 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113335] [ENSMUST00000113337]
AlphaFold Q6WKZ8
Predicted Effect probably damaging
Transcript: ENSMUST00000113335
AA Change: P1696H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108961
Gene: ENSMUSG00000023977
AA Change: P1696H

DomainStartEndE-ValueType
ZnF_UBR1 97 167 3.14e-32 SMART
Pfam:ClpS 221 302 2.4e-23 PFAM
low complexity region 635 646 N/A INTRINSIC
low complexity region 749 760 N/A INTRINSIC
low complexity region 872 886 N/A INTRINSIC
coiled coil region 1019 1046 N/A INTRINSIC
RING 1108 1213 7.66e-1 SMART
low complexity region 1221 1235 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000113337
AA Change: P1696H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108963
Gene: ENSMUSG00000023977
AA Change: P1696H

DomainStartEndE-ValueType
ZnF_UBR1 97 167 3.14e-32 SMART
Pfam:ClpS 222 301 6.2e-26 PFAM
low complexity region 635 646 N/A INTRINSIC
low complexity region 749 760 N/A INTRINSIC
low complexity region 872 886 N/A INTRINSIC
coiled coil region 1019 1046 N/A INTRINSIC
RING 1108 1213 7.66e-1 SMART
low complexity region 1221 1235 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224442
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224759
Meta Mutation Damage Score 0.9729 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.5%
Validation Efficiency 100% (72/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an E3 ubiquitin ligase of the N-end rule proteolytic pathway that targets proteins with destabilizing N-terminal residues for polyubiquitylation and proteasome-mediated degradation. Alternative splicing results in multiple transcript variants.[provided by RefSeq, May 2010]
PHENOTYPE: On a mixed genetic background, female homozygotes for a targeted null mutation exhibit embryonic lethality, while males are viable, but sterile due to postnatal testicular degeneration. On an inbred background, both genders die in utero. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrl2 T A 3: 148,852,762 T437S probably benign Het
Akna A G 4: 63,379,333 F828S probably benign Het
Alg9 G T 9: 50,775,502 A40S possibly damaging Het
Alox8 T A 11: 69,185,241 H628L possibly damaging Het
Aox3 T C 1: 58,152,554 W422R probably benign Het
Atp13a4 T C 16: 29,409,710 D984G probably benign Het
Bcam T C 7: 19,760,382 E363G possibly damaging Het
Cadps2 C A 6: 23,429,218 V519F probably damaging Het
Calca A G 7: 114,635,161 Y18H probably damaging Het
Cd70 A G 17: 57,146,364 I100T probably damaging Het
Cdk4 T A 10: 127,064,651 H95Q probably damaging Het
Chchd1 T A 14: 20,703,342 N11K probably damaging Het
Cma2 T A 14: 55,972,815 N52K probably damaging Het
Cyp3a16 A G 5: 145,436,457 V500A probably benign Het
Dicer1 A G 12: 104,721,969 probably null Het
Dnajc13 A G 9: 104,156,838 S2206P probably benign Het
Dtl T C 1: 191,561,546 probably null Het
Fam186b T C 15: 99,286,971 T24A probably benign Het
Fbxw21 A G 9: 109,161,916 V25A probably benign Het
Gins1 T C 2: 150,912,838 S45P probably benign Het
Gtpbp2 T A 17: 46,165,943 V349D probably damaging Het
Hyal5 G T 6: 24,876,793 D222Y probably damaging Het
Itgal A G 7: 127,300,888 probably null Het
Klk14 A G 7: 43,693,953 probably null Het
Lama1 T A 17: 67,810,409 L2518Q possibly damaging Het
Lrrc2 G A 9: 110,979,487 G264D probably benign Het
Ltbp4 A G 7: 27,322,820 S893P probably damaging Het
Mast4 G A 13: 102,739,263 P1107L probably damaging Het
Mbd1 T A 18: 74,275,419 probably null Het
Naip2 A T 13: 100,155,021 D1136E probably benign Het
Naip2 G A 13: 100,155,029 probably benign Het
Ncan G A 8: 70,110,198 T470I probably benign Het
Npy1r A T 8: 66,704,161 I78F probably damaging Het
Olfr1491 A T 19: 13,705,525 M233L probably benign Het
Olfr917 G A 9: 38,665,277 T189M probably damaging Het
Palb2 A T 7: 122,110,838 probably null Het
Pax3 T C 1: 78,103,484 T422A probably benign Het
Pebp1 A T 5: 117,286,164 D72E possibly damaging Het
Pnliprp1 A T 19: 58,740,469 T363S probably benign Het
Rbm44 G A 1: 91,156,843 probably null Het
Rbm47 T A 5: 66,025,015 Y425F probably benign Het
Robo3 G T 9: 37,429,661 A83E probably damaging Het
Rrm1 A G 7: 102,456,514 Y279C probably damaging Het
Rslcan18 A T 13: 67,108,057 probably benign Het
Scara5 C A 14: 65,730,865 Q196K probably benign Het
Setd1b C T 5: 123,163,147 probably benign Het
Siah1a A G 8: 86,725,241 F205S probably damaging Het
Smr2 AT ATT 5: 88,108,824 probably null Het
Ssu72 A G 4: 155,731,357 D86G probably benign Het
St7 G T 6: 17,886,111 K357N probably damaging Het
Sv2b G A 7: 75,147,677 T323I probably damaging Het
Syt1 T C 10: 108,504,500 N319S probably benign Het
Tanc1 T A 2: 59,791,651 F371L probably damaging Het
Tcf20 C A 15: 82,855,492 G586V probably benign Het
Tg T C 15: 66,729,685 probably null Het
Tyk2 A T 9: 21,115,462 N620K probably benign Het
Ube2j1 T A 4: 33,045,116 S130T probably benign Het
Ubr5 A T 15: 38,040,841 D266E probably damaging Het
Vipr2 A G 12: 116,144,272 T426A probably benign Het
Vmn2r104 A T 17: 20,042,215 W218R probably damaging Het
Vmn2r83 T A 10: 79,479,122 N401K probably damaging Het
Vwf A G 6: 125,655,251 E82G unknown Het
Vwf T A 6: 125,663,571 Y2323* probably null Het
Wdr76 T G 2: 121,528,921 V329G probably damaging Het
Zan A G 5: 137,461,952 C1226R unknown Het
Zbtb16 G T 9: 48,832,272 Q247K probably damaging Het
Zfp541 T C 7: 16,078,715 V431A possibly damaging Het
Other mutations in Ubr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00324:Ubr2 APN 17 46986060 splice site probably benign
IGL00332:Ubr2 APN 17 46990990 critical splice donor site probably null
IGL00518:Ubr2 APN 17 46992996 missense probably damaging 1.00
IGL00693:Ubr2 APN 17 46972981 missense probably benign 0.01
IGL00785:Ubr2 APN 17 46944865 missense possibly damaging 0.69
IGL01144:Ubr2 APN 17 46957321 missense probably damaging 1.00
IGL01459:Ubr2 APN 17 46930509 splice site probably benign
IGL01637:Ubr2 APN 17 46956654 missense probably damaging 1.00
IGL01710:Ubr2 APN 17 46943409 missense probably benign 0.00
IGL01726:Ubr2 APN 17 46992981 splice site probably benign
IGL01925:Ubr2 APN 17 46954949 missense possibly damaging 0.92
IGL01960:Ubr2 APN 17 46973967 missense probably benign 0.45
IGL02170:Ubr2 APN 17 46967197 missense probably benign 0.05
IGL02308:Ubr2 APN 17 46934193 missense probably damaging 1.00
IGL02387:Ubr2 APN 17 46963150 missense probably benign
IGL02696:Ubr2 APN 17 46963765 missense probably benign
IGL02726:Ubr2 APN 17 46972921 missense probably damaging 1.00
IGL02750:Ubr2 APN 17 46969282 missense probably benign 0.00
IGL02934:Ubr2 APN 17 46957340 missense possibly damaging 0.50
IGL02959:Ubr2 APN 17 46975951 missense probably damaging 0.96
IGL03018:Ubr2 APN 17 46954046 missense possibly damaging 0.64
IGL03343:Ubr2 APN 17 46951918 missense probably benign 0.00
PIT4280001:Ubr2 UTSW 17 46944863 missense probably damaging 1.00
R0044:Ubr2 UTSW 17 46992985 splice site probably benign
R0044:Ubr2 UTSW 17 46992985 splice site probably benign
R0446:Ubr2 UTSW 17 46983298 missense probably damaging 1.00
R0513:Ubr2 UTSW 17 46986779 nonsense probably null
R0565:Ubr2 UTSW 17 46955886 missense probably damaging 1.00
R0600:Ubr2 UTSW 17 46967248 missense probably damaging 0.99
R0690:Ubr2 UTSW 17 46938653 missense probably damaging 0.97
R0710:Ubr2 UTSW 17 46938681 missense probably damaging 0.96
R0761:Ubr2 UTSW 17 46983316 missense probably damaging 1.00
R0798:Ubr2 UTSW 17 46969176 splice site probably benign
R0862:Ubr2 UTSW 17 46967083 nonsense probably null
R0947:Ubr2 UTSW 17 46941112 missense probably damaging 0.99
R0972:Ubr2 UTSW 17 46934261 splice site probably null
R1500:Ubr2 UTSW 17 46986689 missense possibly damaging 0.79
R1514:Ubr2 UTSW 17 47000823 missense probably damaging 1.00
R1533:Ubr2 UTSW 17 46967247 nonsense probably null
R1554:Ubr2 UTSW 17 46972951 missense probably benign
R1602:Ubr2 UTSW 17 46941061 missense probably benign 0.30
R1941:Ubr2 UTSW 17 46974026 missense probably damaging 1.00
R1966:Ubr2 UTSW 17 46954919 missense probably benign 0.05
R2041:Ubr2 UTSW 17 46986047 missense probably damaging 1.00
R2067:Ubr2 UTSW 17 46963145 critical splice donor site probably null
R2111:Ubr2 UTSW 17 46963145 critical splice donor site probably null
R2189:Ubr2 UTSW 17 46943364 missense probably benign 0.01
R2219:Ubr2 UTSW 17 46986042 missense possibly damaging 0.94
R2307:Ubr2 UTSW 17 46966215 nonsense probably null
R3426:Ubr2 UTSW 17 46968439 missense probably damaging 1.00
R3428:Ubr2 UTSW 17 46968439 missense probably damaging 1.00
R3608:Ubr2 UTSW 17 46944523 missense probably damaging 1.00
R4080:Ubr2 UTSW 17 46988722 missense probably benign 0.05
R4330:Ubr2 UTSW 17 46967278 missense probably null 1.00
R4383:Ubr2 UTSW 17 46939387 missense probably benign 0.01
R4460:Ubr2 UTSW 17 46945045 critical splice donor site probably null
R4794:Ubr2 UTSW 17 46930445 missense probably damaging 1.00
R4902:Ubr2 UTSW 17 46985996 missense possibly damaging 0.91
R4913:Ubr2 UTSW 17 46959459 splice site probably null
R5092:Ubr2 UTSW 17 46969247 missense probably damaging 1.00
R5209:Ubr2 UTSW 17 46968424 missense probably damaging 1.00
R5226:Ubr2 UTSW 17 46983270 missense probably benign 0.04
R5250:Ubr2 UTSW 17 46930442 missense probably benign 0.01
R5437:Ubr2 UTSW 17 46963697 missense probably benign 0.00
R5607:Ubr2 UTSW 17 46934200 nonsense probably null
R5848:Ubr2 UTSW 17 46956655 missense possibly damaging 0.84
R6089:Ubr2 UTSW 17 46982292 missense possibly damaging 0.95
R6382:Ubr2 UTSW 17 46957315 missense possibly damaging 0.56
R6552:Ubr2 UTSW 17 46966268 splice site probably null
R6630:Ubr2 UTSW 17 46951984 missense possibly damaging 0.51
R6892:Ubr2 UTSW 17 46934108 missense probably damaging 0.99
R6936:Ubr2 UTSW 17 46973031 missense possibly damaging 0.94
R7039:Ubr2 UTSW 17 47010213 missense probably benign 0.01
R7050:Ubr2 UTSW 17 46961602 missense probably benign 0.30
R7078:Ubr2 UTSW 17 46955853 missense possibly damaging 0.59
R7126:Ubr2 UTSW 17 46974056 splice site probably null
R7219:Ubr2 UTSW 17 46935434 nonsense probably null
R7262:Ubr2 UTSW 17 47000739 missense probably damaging 0.97
R7352:Ubr2 UTSW 17 46930426 missense probably benign 0.19
R7366:Ubr2 UTSW 17 46955845 missense probably damaging 0.99
R7449:Ubr2 UTSW 17 46964788 missense probably damaging 1.00
R7496:Ubr2 UTSW 17 46990991 critical splice donor site probably null
R7759:Ubr2 UTSW 17 46986048 missense probably damaging 1.00
R7869:Ubr2 UTSW 17 46991008 missense probably benign 0.00
R7916:Ubr2 UTSW 17 46968382 critical splice donor site probably null
R8236:Ubr2 UTSW 17 46951909 missense probably benign
R8376:Ubr2 UTSW 17 46942795 missense probably benign 0.07
R9026:Ubr2 UTSW 17 46934115 missense probably damaging 1.00
R9216:Ubr2 UTSW 17 46981359 missense probably benign 0.36
R9339:Ubr2 UTSW 17 46973939 missense probably benign 0.30
R9558:Ubr2 UTSW 17 46951917 missense not run
X0027:Ubr2 UTSW 17 47000629 missense probably damaging 0.99
X0061:Ubr2 UTSW 17 46970111 missense possibly damaging 0.88
Z1177:Ubr2 UTSW 17 46959509 missense probably benign
Z1177:Ubr2 UTSW 17 47000766 missense possibly damaging 0.76
Z1177:Ubr2 UTSW 17 47010143 missense probably benign 0.33
Predicted Primers PCR Primer
(F):5'- GTCCACAGGTGACAAGTCCACG -3'
(R):5'- TGGGCGGATACCTTGCTACTCG -3'

Sequencing Primer
(F):5'- ACGGGTGACAAGCTACCTTC -3'
(R):5'- AGCTGCTCTCGTCTCCTG -3'
Posted On 2014-04-13