Incidental Mutation 'R1575:Olfr1491'
ID171138
Institutional Source Beutler Lab
Gene Symbol Olfr1491
Ensembl Gene ENSMUSG00000051156
Gene Nameolfactory receptor 1491
SynonymsGA_x6K02T2RE5P-4037809-4038768, MOR266-8
MMRRC Submission 039613-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1575 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location13697268-13706127 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 13705525 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 233 (M233L)
Ref Sequence ENSEMBL: ENSMUSP00000149884 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052737] [ENSMUST00000214007] [ENSMUST00000215493] [ENSMUST00000216366] [ENSMUST00000216377] [ENSMUST00000216622]
Predicted Effect probably benign
Transcript: ENSMUST00000052737
AA Change: M233L

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000057902
Gene: ENSMUSG00000051156
AA Change: M233L

DomainStartEndE-ValueType
Pfam:7tm_4 35 314 3.3e-52 PFAM
Pfam:7tm_1 45 295 5.9e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214007
AA Change: M233L

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
Predicted Effect probably benign
Transcript: ENSMUST00000215493
AA Change: M233L

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
Predicted Effect probably benign
Transcript: ENSMUST00000216366
AA Change: M233L

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
Predicted Effect probably benign
Transcript: ENSMUST00000216377
AA Change: M233L

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
Predicted Effect probably benign
Transcript: ENSMUST00000216622
AA Change: M233L

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.5%
Validation Efficiency 100% (72/72)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrl2 T A 3: 148,852,762 T437S probably benign Het
Akna A G 4: 63,379,333 F828S probably benign Het
Alg9 G T 9: 50,775,502 A40S possibly damaging Het
Alox8 T A 11: 69,185,241 H628L possibly damaging Het
Aox3 T C 1: 58,152,554 W422R probably benign Het
Atp13a4 T C 16: 29,409,710 D984G probably benign Het
Bcam T C 7: 19,760,382 E363G possibly damaging Het
Cadps2 C A 6: 23,429,218 V519F probably damaging Het
Calca A G 7: 114,635,161 Y18H probably damaging Het
Cd70 A G 17: 57,146,364 I100T probably damaging Het
Cdk4 T A 10: 127,064,651 H95Q probably damaging Het
Chchd1 T A 14: 20,703,342 N11K probably damaging Het
Cma2 T A 14: 55,972,815 N52K probably damaging Het
Cyp3a16 A G 5: 145,436,457 V500A probably benign Het
Dicer1 A G 12: 104,721,969 probably null Het
Dnajc13 A G 9: 104,156,838 S2206P probably benign Het
Dtl T C 1: 191,561,546 probably null Het
Fam186b T C 15: 99,286,971 T24A probably benign Het
Fbxw21 A G 9: 109,161,916 V25A probably benign Het
Gins1 T C 2: 150,912,838 S45P probably benign Het
Gtpbp2 T A 17: 46,165,943 V349D probably damaging Het
Hyal5 G T 6: 24,876,793 D222Y probably damaging Het
Itgal A G 7: 127,300,888 probably null Het
Klk14 A G 7: 43,693,953 probably null Het
Lama1 T A 17: 67,810,409 L2518Q possibly damaging Het
Lrrc2 G A 9: 110,979,487 G264D probably benign Het
Ltbp4 A G 7: 27,322,820 S893P probably damaging Het
Mast4 G A 13: 102,739,263 P1107L probably damaging Het
Mbd1 T A 18: 74,275,419 probably null Het
Naip2 A T 13: 100,155,021 D1136E probably benign Het
Naip2 G A 13: 100,155,029 probably benign Het
Ncan G A 8: 70,110,198 T470I probably benign Het
Npy1r A T 8: 66,704,161 I78F probably damaging Het
Olfr917 G A 9: 38,665,277 T189M probably damaging Het
Palb2 A T 7: 122,110,838 probably null Het
Pax3 T C 1: 78,103,484 T422A probably benign Het
Pebp1 A T 5: 117,286,164 D72E possibly damaging Het
Pnliprp1 A T 19: 58,740,469 T363S probably benign Het
Rbm44 G A 1: 91,156,843 probably null Het
Rbm47 T A 5: 66,025,015 Y425F probably benign Het
Robo3 G T 9: 37,429,661 A83E probably damaging Het
Rrm1 A G 7: 102,456,514 Y279C probably damaging Het
Rslcan18 A T 13: 67,108,057 probably benign Het
Scara5 C A 14: 65,730,865 Q196K probably benign Het
Setd1b C T 5: 123,163,147 probably benign Het
Siah1a A G 8: 86,725,241 F205S probably damaging Het
Smr2 AT ATT 5: 88,108,824 probably null Het
Ssu72 A G 4: 155,731,357 D86G probably benign Het
St7 G T 6: 17,886,111 K357N probably damaging Het
Sv2b G A 7: 75,147,677 T323I probably damaging Het
Syt1 T C 10: 108,504,500 N319S probably benign Het
Tanc1 T A 2: 59,791,651 F371L probably damaging Het
Tcf20 C A 15: 82,855,492 G586V probably benign Het
Tg T C 15: 66,729,685 probably null Het
Tyk2 A T 9: 21,115,462 N620K probably benign Het
Ube2j1 T A 4: 33,045,116 S130T probably benign Het
Ubr2 G T 17: 46,932,492 P1696H probably damaging Het
Ubr5 A T 15: 38,040,841 D266E probably damaging Het
Vipr2 A G 12: 116,144,272 T426A probably benign Het
Vmn2r104 A T 17: 20,042,215 W218R probably damaging Het
Vmn2r83 T A 10: 79,479,122 N401K probably damaging Het
Vwf A G 6: 125,655,251 E82G unknown Het
Vwf T A 6: 125,663,571 Y2323* probably null Het
Wdr76 T G 2: 121,528,921 V329G probably damaging Het
Zan A G 5: 137,461,952 C1226R unknown Het
Zbtb16 G T 9: 48,832,272 Q247K probably damaging Het
Zfp541 T C 7: 16,078,715 V431A possibly damaging Het
Other mutations in Olfr1491
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00958:Olfr1491 APN 19 13705732 missense probably benign 0.05
IGL02713:Olfr1491 APN 19 13705189 missense possibly damaging 0.78
IGL02822:Olfr1491 APN 19 13705655 missense probably benign 0.13
R0083:Olfr1491 UTSW 19 13705678 missense probably damaging 0.99
R0108:Olfr1491 UTSW 19 13705678 missense probably damaging 0.99
R0271:Olfr1491 UTSW 19 13705135 missense probably benign 0.03
R1364:Olfr1491 UTSW 19 13705445 missense probably benign 0.11
R1538:Olfr1491 UTSW 19 13705496 missense probably damaging 1.00
R1579:Olfr1491 UTSW 19 13705202 missense probably damaging 1.00
R2179:Olfr1491 UTSW 19 13705394 missense probably damaging 0.98
R4393:Olfr1491 UTSW 19 13705190 missense possibly damaging 0.50
R5837:Olfr1491 UTSW 19 13704960 nonsense probably null
R6001:Olfr1491 UTSW 19 13705060 missense probably damaging 0.98
R8064:Olfr1491 UTSW 19 13705022 missense not run
Z1176:Olfr1491 UTSW 19 13705203 missense not run
Predicted Primers PCR Primer
(F):5'- ACCAAGAAGCTGTGTGTTCAGATGG -3'
(R):5'- AGAGCACCTTTGACATCCTTGTTCC -3'

Sequencing Primer
(F):5'- CTGTGGACATTACCTGGAAATCAAC -3'
(R):5'- CCTTGTTCCTAAGGGTATAAATCAG -3'
Posted On2014-04-13