Incidental Mutation 'R1576:Stk17b'
ID171140
Institutional Source Beutler Lab
Gene Symbol Stk17b
Ensembl Gene ENSMUSG00000026094
Gene Nameserine/threonine kinase 17b (apoptosis-inducing)
Synonyms3110009A03Rik, Drak2
MMRRC Submission 039614-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.103) question?
Stock #R1576 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location53755506-53785224 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 53757590 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 339 (D339E)
Ref Sequence ENSEMBL: ENSMUSP00000027263 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027263] [ENSMUST00000185920]
Predicted Effect probably damaging
Transcript: ENSMUST00000027263
AA Change: D339E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000027263
Gene: ENSMUSG00000026094
AA Change: D339E

DomainStartEndE-ValueType
S_TKc 33 293 5.77e-79 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000185920
SMART Domains Protein: ENSMUSP00000139880
Gene: ENSMUSG00000026094

DomainStartEndE-ValueType
S_TKc 1 93 5.8e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187066
Meta Mutation Damage Score 0.0803 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 92.1%
Validation Efficiency 100% (49/49)
MGI Phenotype PHENOTYPE: Homozygous null mice display abnormal T cell numbers, increased T cell proliferation, abnormal cytokine physiology, and decreased susceptibility to experimental autoimmune encephalomyelitis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ap3m2 G A 8: 22,808,467 probably benign Het
Apol11a T A 15: 77,516,931 I206N probably damaging Het
Arfgap3 A G 15: 83,313,563 S331P possibly damaging Het
Arhgef16 A C 4: 154,291,312 L75R probably damaging Het
Cfi T C 3: 129,873,050 V474A probably damaging Het
Dhx8 T C 11: 101,752,319 V739A probably damaging Het
Dpy19l2 T A 9: 24,584,502 H640L probably benign Het
Eif4g3 T A 4: 138,096,870 M57K probably damaging Het
Emilin2 A G 17: 71,255,117 probably null Het
Epc1 T C 18: 6,452,366 E281G possibly damaging Het
Fancd2 G T 6: 113,578,405 S1125I probably damaging Het
Fh1 G A 1: 175,607,819 P366L probably null Het
Gata3 A T 2: 9,863,196 S316T probably damaging Het
Hmcn1 A T 1: 150,657,241 S3064T possibly damaging Het
Inpp5d A T 1: 87,669,685 T193S probably benign Het
Inpp5d A T 1: 87,681,558 I277F probably damaging Het
Itga5 T C 15: 103,351,617 D616G probably damaging Het
Jade1 T A 3: 41,591,807 V89E probably damaging Het
Lamb2 T C 9: 108,480,307 S81P probably damaging Het
Lrrc19 G A 4: 94,639,353 P207L probably damaging Het
Maea A G 5: 33,362,696 D147G probably damaging Het
Muc6 T A 7: 141,634,524 E2767V possibly damaging Het
Myom2 A G 8: 15,084,556 Y453C probably damaging Het
Naip2 A T 13: 100,155,021 D1136E probably benign Het
Naip2 G A 13: 100,155,029 probably benign Het
Nap1l1 A G 10: 111,494,820 D362G probably damaging Het
Nap1l4 C T 7: 143,538,216 probably null Het
Nudt21 A C 8: 94,028,833 probably null Het
Nufip1 A G 14: 76,134,870 N475D probably benign Het
Pcdhb8 A G 18: 37,356,703 D478G probably damaging Het
Pla2g4d A G 2: 120,284,167 S28P probably damaging Het
Polr2j C A 5: 136,120,028 N29K probably damaging Het
Ppp2r2a A G 14: 67,038,869 probably benign Het
Ptprk A G 10: 28,551,651 D742G probably damaging Het
Pum2 A G 12: 8,713,524 D227G probably benign Het
Rfxank C A 8: 70,134,303 R221L possibly damaging Het
Shank3 C A 15: 89,503,663 Q317K probably benign Het
Slc22a17 A G 14: 54,907,990 V460A probably damaging Het
Slc39a11 G T 11: 113,559,535 D41E probably damaging Het
Spag17 T C 3: 99,939,363 S68P possibly damaging Het
Sstr5 C T 17: 25,491,298 C319Y possibly damaging Het
Tagln2 A G 1: 172,505,221 D25G probably benign Het
Ttn C T 2: 76,794,850 V13417I probably benign Het
Vps50 A G 6: 3,545,568 E334G possibly damaging Het
Zfp316 T C 5: 143,264,094 E138G unknown Het
Zfp879 T A 11: 50,833,549 T227S probably benign Het
Other mutations in Stk17b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00722:Stk17b APN 1 53764140 missense probably damaging 0.99
IGL00767:Stk17b APN 1 53764023 splice site probably benign
IGL01012:Stk17b APN 1 53761037 missense probably benign 0.06
IGL01431:Stk17b APN 1 53765915 splice site probably benign
IGL01914:Stk17b APN 1 53761067 missense probably damaging 0.98
IGL02236:Stk17b APN 1 53764088 missense probably damaging 1.00
IGL02827:Stk17b APN 1 53776542 missense probably benign 0.03
R0013:Stk17b UTSW 1 53764132 missense probably benign 0.36
R0545:Stk17b UTSW 1 53762583 splice site probably benign
R0831:Stk17b UTSW 1 53757492 missense probably damaging 1.00
R1035:Stk17b UTSW 1 53762599 missense probably benign 0.22
R1375:Stk17b UTSW 1 53765947 missense possibly damaging 0.83
R1809:Stk17b UTSW 1 53765981 missense possibly damaging 0.80
R1988:Stk17b UTSW 1 53761082 missense probably damaging 1.00
R2033:Stk17b UTSW 1 53761076 missense probably damaging 1.00
R2105:Stk17b UTSW 1 53776605 missense probably benign 0.01
R2255:Stk17b UTSW 1 53776572 missense probably benign 0.00
R4395:Stk17b UTSW 1 53764115 missense probably damaging 0.98
R4521:Stk17b UTSW 1 53764038 missense probably damaging 1.00
R4777:Stk17b UTSW 1 53771708 missense probably damaging 1.00
R4871:Stk17b UTSW 1 53757534 missense probably benign 0.14
R4892:Stk17b UTSW 1 53771611 missense probably damaging 0.99
R4999:Stk17b UTSW 1 53761147 unclassified probably null
R5122:Stk17b UTSW 1 53776558 missense probably damaging 1.00
R5621:Stk17b UTSW 1 53771784 nonsense probably null
R6636:Stk17b UTSW 1 53761088 missense probably damaging 1.00
R6924:Stk17b UTSW 1 53761059 missense possibly damaging 0.54
R7283:Stk17b UTSW 1 53757515 missense probably benign
R7322:Stk17b UTSW 1 53765945 missense probably benign 0.16
R7671:Stk17b UTSW 1 53766000 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGACAGCATTTCCCCAAACAGATTCTC -3'
(R):5'- TCTCTGCTTTCTGCCAAAGGAAAAGAC -3'

Sequencing Primer
(F):5'- GGTATAGGGCTTACCTTAGAACC -3'
(R):5'- AGACCAACAGCAGAATCCTG -3'
Posted On2014-04-13