Incidental Mutation 'R1576:Inpp5d'
ID171141
Institutional Source Beutler Lab
Gene Symbol Inpp5d
Ensembl Gene ENSMUSG00000026288
Gene Nameinositol polyphosphate-5-phosphatase D
Synonymss-SHIP, SHIP, Src homology 2 domain-containing inositol-5-phosphatase, SHIP1, SHIP-1
MMRRC Submission 039614-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.902) question?
Stock #R1576 (G1)
Quality Score147
Status Validated
Chromosome1
Chromosomal Location87620312-87720507 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 87669685 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 193 (T193S)
Ref Sequence ENSEMBL: ENSMUSP00000127941 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042275] [ENSMUST00000072999] [ENSMUST00000163576] [ENSMUST00000168783] [ENSMUST00000169754]
Predicted Effect probably benign
Transcript: ENSMUST00000042275
AA Change: T192S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000044647
Gene: ENSMUSG00000026288
AA Change: T192S

DomainStartEndE-ValueType
SH2 6 95 7.15e-29 SMART
low complexity region 107 120 N/A INTRINSIC
IPPc 404 720 4.5e-104 SMART
low complexity region 767 777 N/A INTRINSIC
low complexity region 954 979 N/A INTRINSIC
low complexity region 1045 1057 N/A INTRINSIC
low complexity region 1119 1131 N/A INTRINSIC
low complexity region 1139 1148 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000072999
AA Change: T192S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000072763
Gene: ENSMUSG00000026288
AA Change: T192S

DomainStartEndE-ValueType
SH2 6 95 7.15e-29 SMART
low complexity region 107 120 N/A INTRINSIC
IPPc 404 720 4.5e-104 SMART
low complexity region 767 777 N/A INTRINSIC
low complexity region 932 953 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163576
Predicted Effect probably benign
Transcript: ENSMUST00000165554
SMART Domains Protein: ENSMUSP00000128700
Gene: ENSMUSG00000026288

DomainStartEndE-ValueType
SCOP:d1d4ta_ 17 75 1e-12 SMART
Blast:SH2 19 65 2e-28 BLAST
PDB:2YSX|A 19 76 1e-36 PDB
low complexity region 77 88 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000168783
AA Change: T193S

PolyPhen 2 Score 0.160 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000131244
Gene: ENSMUSG00000026288
AA Change: T193S

DomainStartEndE-ValueType
SH2 6 95 7.15e-29 SMART
low complexity region 107 118 N/A INTRINSIC
IPPc 405 721 4.5e-104 SMART
low complexity region 768 778 N/A INTRINSIC
low complexity region 985 997 N/A INTRINSIC
low complexity region 1059 1071 N/A INTRINSIC
low complexity region 1079 1088 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000169754
AA Change: T193S

PolyPhen 2 Score 0.160 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000127941
Gene: ENSMUSG00000026288
AA Change: T193S

DomainStartEndE-ValueType
SH2 6 95 4.6e-31 SMART
low complexity region 107 118 N/A INTRINSIC
IPPc 405 721 2.2e-106 SMART
low complexity region 768 778 N/A INTRINSIC
low complexity region 955 980 N/A INTRINSIC
low complexity region 1046 1058 N/A INTRINSIC
low complexity region 1120 1132 N/A INTRINSIC
low complexity region 1140 1149 N/A INTRINSIC
Meta Mutation Damage Score 0.0910 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 92.1%
Validation Efficiency 100% (49/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the inositol polyphosphate-5-phosphatase (INPP5) family and encodes a protein with an N-terminal SH2 domain, an inositol phosphatase domain, and two C-terminal protein interaction domains. Expression of this protein is restricted to hematopoietic cells where its movement from the cytosol to the plasma membrane is mediated by tyrosine phosphorylation. At the plasma membrane, the protein hydrolyzes the 5' phosphate from phosphatidylinositol (3,4,5)-trisphosphate and inositol-1,3,4,5-tetrakisphosphate, thereby affecting multiple signaling pathways. The protein is also partly localized to the nucleus, where it may be involved in nuclear inositol phosphate signaling processes. Overall, the protein functions as a negative regulator of myeloid cell proliferation and survival. Mutations in this gene are associated with defects and cancers of the immune system. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Feb 2014]
PHENOTYPE: Homozygous null mice fail to reject fully mismatched allogeneic marrow grafts, do not develop graft versus host disease, and show enhanced survival after such transplants. Homozygous splice site mutants exhibit wasting, granulocytic lung infiltration anddefective cytolysis by NK cells and CTLs. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ap3m2 G A 8: 22,808,467 probably benign Het
Apol11a T A 15: 77,516,931 I206N probably damaging Het
Arfgap3 A G 15: 83,313,563 S331P possibly damaging Het
Arhgef16 A C 4: 154,291,312 L75R probably damaging Het
Cfi T C 3: 129,873,050 V474A probably damaging Het
Dhx8 T C 11: 101,752,319 V739A probably damaging Het
Dpy19l2 T A 9: 24,584,502 H640L probably benign Het
Eif4g3 T A 4: 138,096,870 M57K probably damaging Het
Emilin2 A G 17: 71,255,117 probably null Het
Epc1 T C 18: 6,452,366 E281G possibly damaging Het
Fancd2 G T 6: 113,578,405 S1125I probably damaging Het
Fh1 G A 1: 175,607,819 P366L probably null Het
Gata3 A T 2: 9,863,196 S316T probably damaging Het
Hmcn1 A T 1: 150,657,241 S3064T possibly damaging Het
Itga5 T C 15: 103,351,617 D616G probably damaging Het
Jade1 T A 3: 41,591,807 V89E probably damaging Het
Lamb2 T C 9: 108,480,307 S81P probably damaging Het
Lrrc19 G A 4: 94,639,353 P207L probably damaging Het
Maea A G 5: 33,362,696 D147G probably damaging Het
Muc6 T A 7: 141,634,524 E2767V possibly damaging Het
Myom2 A G 8: 15,084,556 Y453C probably damaging Het
Naip2 A T 13: 100,155,021 D1136E probably benign Het
Naip2 G A 13: 100,155,029 probably benign Het
Nap1l1 A G 10: 111,494,820 D362G probably damaging Het
Nap1l4 C T 7: 143,538,216 probably null Het
Nudt21 A C 8: 94,028,833 probably null Het
Nufip1 A G 14: 76,134,870 N475D probably benign Het
Pcdhb8 A G 18: 37,356,703 D478G probably damaging Het
Pla2g4d A G 2: 120,284,167 S28P probably damaging Het
Polr2j C A 5: 136,120,028 N29K probably damaging Het
Ppp2r2a A G 14: 67,038,869 probably benign Het
Ptprk A G 10: 28,551,651 D742G probably damaging Het
Pum2 A G 12: 8,713,524 D227G probably benign Het
Rfxank C A 8: 70,134,303 R221L possibly damaging Het
Shank3 C A 15: 89,503,663 Q317K probably benign Het
Slc22a17 A G 14: 54,907,990 V460A probably damaging Het
Slc39a11 G T 11: 113,559,535 D41E probably damaging Het
Spag17 T C 3: 99,939,363 S68P possibly damaging Het
Sstr5 C T 17: 25,491,298 C319Y possibly damaging Het
Stk17b G T 1: 53,757,590 D339E probably damaging Het
Tagln2 A G 1: 172,505,221 D25G probably benign Het
Ttn C T 2: 76,794,850 V13417I probably benign Het
Vps50 A G 6: 3,545,568 E334G possibly damaging Het
Zfp316 T C 5: 143,264,094 E138G unknown Het
Zfp879 T A 11: 50,833,549 T227S probably benign Het
Other mutations in Inpp5d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00323:Inpp5d APN 1 87683815 missense probably benign 0.00
IGL00329:Inpp5d APN 1 87668003 missense probably benign 0.00
IGL00897:Inpp5d APN 1 87712114 missense probably benign 0.14
IGL01314:Inpp5d APN 1 87683750 nonsense probably null
IGL02145:Inpp5d APN 1 87715055 missense probably damaging 1.00
IGL02422:Inpp5d APN 1 87708132 missense probably damaging 1.00
IGL02538:Inpp5d APN 1 87695366 missense probably null 0.92
IGL02680:Inpp5d APN 1 87701483 missense possibly damaging 0.87
IGL03083:Inpp5d APN 1 87711141 missense probably damaging 1.00
IGL03308:Inpp5d APN 1 87703197 missense probably damaging 1.00
americas UTSW 1 87715142 missense probably damaging 1.00
Apfelsine UTSW 1 87683845 nonsense probably null
Auburn UTSW 1 87681680 splice site probably null
naranjo UTSW 1 87708211 critical splice donor site probably null
New_black UTSW 1 87709675 missense probably damaging 1.00
Orange UTSW 1 87697546 critical splice donor site probably null
pantone UTSW 1 87699675 missense probably damaging 1.00
sailing UTSW 1 87705964 missense probably damaging 1.00
Salamander UTSW 1 87695380 missense probably damaging 0.99
Sandstone UTSW 1 87695400 missense probably damaging 1.00
styx UTSW 1 87669784 critical splice donor site probably benign
tangerine UTSW 1 87705949 missense probably damaging 1.00
ulster UTSW 1 87701476 nonsense probably null
R0010:Inpp5d UTSW 1 87697546 critical splice donor site probably null
R0037:Inpp5d UTSW 1 87708129 missense probably damaging 0.99
R0087:Inpp5d UTSW 1 87715138 missense probably damaging 1.00
R0492:Inpp5d UTSW 1 87698150 missense possibly damaging 0.94
R0520:Inpp5d UTSW 1 87705920 splice site probably benign
R0733:Inpp5d UTSW 1 87668077 splice site probably benign
R1464:Inpp5d UTSW 1 87698105 splice site probably benign
R1576:Inpp5d UTSW 1 87681558 missense probably damaging 0.96
R1592:Inpp5d UTSW 1 87665532 missense possibly damaging 0.90
R1750:Inpp5d UTSW 1 87699081 missense probably damaging 1.00
R1774:Inpp5d UTSW 1 87667889 missense probably benign 0.30
R1972:Inpp5d UTSW 1 87676314 missense probably benign 0.00
R2024:Inpp5d UTSW 1 87695350 nonsense probably null
R2405:Inpp5d UTSW 1 87699729 missense possibly damaging 0.94
R3412:Inpp5d UTSW 1 87668057 missense possibly damaging 0.93
R3414:Inpp5d UTSW 1 87668057 missense possibly damaging 0.93
R3756:Inpp5d UTSW 1 87701408 splice site probably benign
R4652:Inpp5d UTSW 1 87665451 missense probably benign 0.03
R4676:Inpp5d UTSW 1 87715142 missense probably damaging 1.00
R4834:Inpp5d UTSW 1 87697523 missense possibly damaging 0.52
R5086:Inpp5d UTSW 1 87705964 missense probably damaging 1.00
R5159:Inpp5d UTSW 1 87676342 missense probably damaging 1.00
R5250:Inpp5d UTSW 1 87709675 missense probably damaging 1.00
R5442:Inpp5d UTSW 1 87718066 missense probably benign 0.02
R5875:Inpp5d UTSW 1 87717974 missense possibly damaging 0.47
R6135:Inpp5d UTSW 1 87620397 splice site probably null
R6371:Inpp5d UTSW 1 87699675 missense probably damaging 1.00
R6385:Inpp5d UTSW 1 87699675 missense probably damaging 1.00
R6386:Inpp5d UTSW 1 87699675 missense probably damaging 1.00
R6526:Inpp5d UTSW 1 87676250 start gained probably benign
R6572:Inpp5d UTSW 1 87695396 missense probably damaging 0.99
R6831:Inpp5d UTSW 1 87701476 nonsense probably null
R6853:Inpp5d UTSW 1 87681680 splice site probably null
R6883:Inpp5d UTSW 1 87699690 missense probably damaging 0.98
R7082:Inpp5d UTSW 1 87695380 missense probably damaging 0.99
R7215:Inpp5d UTSW 1 87701218 missense probably benign 0.30
R7418:Inpp5d UTSW 1 87708211 critical splice donor site probably null
R7471:Inpp5d UTSW 1 87695400 missense probably damaging 1.00
R7593:Inpp5d UTSW 1 87717778 missense possibly damaging 0.82
R7716:Inpp5d UTSW 1 87665399 missense probably damaging 0.97
R7781:Inpp5d UTSW 1 87699672 missense probably damaging 1.00
R7808:Inpp5d UTSW 1 87683845 nonsense probably null
R7920:Inpp5d UTSW 1 87705949 missense probably damaging 1.00
Z1176:Inpp5d UTSW 1 87669709 missense probably benign 0.16
Z1176:Inpp5d UTSW 1 87703131 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGGACTTGGCATGAGGGTCAGAC -3'
(R):5'- ACCCAGGGTCACTCTAATGAGCAC -3'

Sequencing Primer
(F):5'- tcaggaggcagaggcag -3'
(R):5'- AATGAGCACTTTCTCTTGCTGTG -3'
Posted On2014-04-13