Mutagenetix > Incidental Mutation

Incidental Mutation 'R1576:Inpp5d'

171142

Institutional Source

Beutler Lab

Gene Symbol

Inpp5d

Ensembl Gene

ENSMUSG00000026288

Gene Name

inositol polyphosphate-5-phosphatase D

Synonyms

s-SHIP, SHIP, Src homology 2 domain-containing inositol-5-phosphatase, SHIP1, SHIP-1

MMRRC Submission

039614-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.908) question?

Stock #

R1576 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

87620312-87720507 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 87681558 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Phenylalanine at position 277 (I277F)

Ref Sequence

ENSEMBL: ENSMUSP00000044647 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000042275] [ENSMUST00000072999] [ENSMUST00000167032] [ENSMUST00000168783] [ENSMUST00000169754] [ENSMUST00000170300]

AlphaFold

Q9ES52

Predicted Effect

probably damaging
Transcript: ENSMUST00000042275
AA Change: I277F

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000044647
Gene: ENSMUSG00000026288
AA Change: I277F

Domain	Start	End	E-Value	Type
SH2	6	95	7.15e-29	SMART
low complexity region	107	120	N/A	INTRINSIC
IPPc	404	720	4.5e-104	SMART
low complexity region	767	777	N/A	INTRINSIC
low complexity region	954	979	N/A	INTRINSIC
low complexity region	1045	1057	N/A	INTRINSIC
low complexity region	1119	1131	N/A	INTRINSIC
low complexity region	1139	1148	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000072999
AA Change: I277F

PolyPhen 2 Score 0.073 (Sensitivity: 0.93; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000072763
Gene: ENSMUSG00000026288
AA Change: I277F

Domain	Start	End	E-Value	Type
SH2	6	95	7.15e-29	SMART
low complexity region	107	120	N/A	INTRINSIC
IPPc	404	720	4.5e-104	SMART
low complexity region	767	777	N/A	INTRINSIC
low complexity region	932	953	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000167032
AA Change: I15F

PolyPhen 2 Score 0.941 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000126569
Gene: ENSMUSG00000026288
AA Change: I15F

Domain	Start	End	E-Value	Type
IPPc	142	458	4.5e-104	SMART
low complexity region	505	515	N/A	INTRINSIC
low complexity region	692	717	N/A	INTRINSIC
low complexity region	783	795	N/A	INTRINSIC
low complexity region	857	869	N/A	INTRINSIC
low complexity region	877	886	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000168783
AA Change: I278F

PolyPhen 2 Score 0.941 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000131244
Gene: ENSMUSG00000026288
AA Change: I278F

Domain	Start	End	E-Value	Type
SH2	6	95	7.15e-29	SMART
low complexity region	107	118	N/A	INTRINSIC
IPPc	405	721	4.5e-104	SMART
low complexity region	768	778	N/A	INTRINSIC
low complexity region	985	997	N/A	INTRINSIC
low complexity region	1059	1071	N/A	INTRINSIC
low complexity region	1079	1088	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000169754
AA Change: I278F

PolyPhen 2 Score 0.941 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000127941
Gene: ENSMUSG00000026288
AA Change: I278F

Domain	Start	End	E-Value	Type
SH2	6	95	4.6e-31	SMART
low complexity region	107	118	N/A	INTRINSIC
IPPc	405	721	2.2e-106	SMART
low complexity region	768	778	N/A	INTRINSIC
low complexity region	955	980	N/A	INTRINSIC
low complexity region	1046	1058	N/A	INTRINSIC
low complexity region	1120	1132	N/A	INTRINSIC
low complexity region	1140	1149	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000170300
AA Change: I15F

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000132384
Gene: ENSMUSG00000026288
AA Change: I15F

Domain	Start	End	E-Value	Type
IPPc	142	458	4.5e-104	SMART
low complexity region	505	515	N/A	INTRINSIC
low complexity region	722	734	N/A	INTRINSIC
low complexity region	796	808	N/A	INTRINSIC
low complexity region	816	825	N/A	INTRINSIC

Meta Mutation Damage Score

0.4556

Coding Region Coverage

1x: 99.1%
3x: 98.2%
10x: 96.0%
20x: 92.1%

Validation Efficiency

100% (49/49)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the inositol polyphosphate-5-phosphatase (INPP5) family and encodes a protein with an N-terminal SH2 domain, an inositol phosphatase domain, and two C-terminal protein interaction domains. Expression of this protein is restricted to hematopoietic cells where its movement from the cytosol to the plasma membrane is mediated by tyrosine phosphorylation. At the plasma membrane, the protein hydrolyzes the 5' phosphate from phosphatidylinositol (3,4,5)-trisphosphate and inositol-1,3,4,5-tetrakisphosphate, thereby affecting multiple signaling pathways. The protein is also partly localized to the nucleus, where it may be involved in nuclear inositol phosphate signaling processes. Overall, the protein functions as a negative regulator of myeloid cell proliferation and survival. Mutations in this gene are associated with defects and cancers of the immune system. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Feb 2014]
PHENOTYPE: Homozygous null mice fail to reject fully mismatched allogeneic marrow grafts, do not develop graft versus host disease, and show enhanced survival after such transplants. Homozygous splice site mutants exhibit wasting, granulocytic lung infiltration anddefective cytolysis by NK cells and CTLs. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 45 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ap3m2	G	A	8: 22,808,467		probably benign	Het
Apol11a	T	A	15: 77,516,931	I206N	probably damaging	Het
Arfgap3	A	G	15: 83,313,563	S331P	possibly damaging	Het
Arhgef16	A	C	4: 154,291,312	L75R	probably damaging	Het
Cfi	T	C	3: 129,873,050	V474A	probably damaging	Het
Dhx8	T	C	11: 101,752,319	V739A	probably damaging	Het
Dpy19l2	T	A	9: 24,584,502	H640L	probably benign	Het
Eif4g3	T	A	4: 138,096,870	M57K	probably damaging	Het
Emilin2	A	G	17: 71,255,117		probably null	Het
Epc1	T	C	18: 6,452,366	E281G	possibly damaging	Het
Fancd2	G	T	6: 113,578,405	S1125I	probably damaging	Het
Fh1	G	A	1: 175,607,819	P366L	probably null	Het
Gata3	A	T	2: 9,863,196	S316T	probably damaging	Het
Hmcn1	A	T	1: 150,657,241	S3064T	possibly damaging	Het
Itga5	T	C	15: 103,351,617	D616G	probably damaging	Het
Jade1	T	A	3: 41,591,807	V89E	probably damaging	Het
Lamb2	T	C	9: 108,480,307	S81P	probably damaging	Het
Lrrc19	G	A	4: 94,639,353	P207L	probably damaging	Het
Maea	A	G	5: 33,362,696	D147G	probably damaging	Het
Muc6	T	A	7: 141,634,524	E2767V	possibly damaging	Het
Myom2	A	G	8: 15,084,556	Y453C	probably damaging	Het
Naip2	A	T	13: 100,155,021	D1136E	probably benign	Het
Naip2	G	A	13: 100,155,029		probably benign	Het
Nap1l1	A	G	10: 111,494,820	D362G	probably damaging	Het
Nap1l4	C	T	7: 143,538,216		probably null	Het
Nudt21	A	C	8: 94,028,833		probably null	Het
Nufip1	A	G	14: 76,134,870	N475D	probably benign	Het
Pcdhb8	A	G	18: 37,356,703	D478G	probably damaging	Het
Pla2g4d	A	G	2: 120,284,167	S28P	probably damaging	Het
Polr2j	C	A	5: 136,120,028	N29K	probably damaging	Het
Ppp2r2a	A	G	14: 67,038,869		probably benign	Het
Ptprk	A	G	10: 28,551,651	D742G	probably damaging	Het
Pum2	A	G	12: 8,713,524	D227G	probably benign	Het
Rfxank	C	A	8: 70,134,303	R221L	possibly damaging	Het
Shank3	C	A	15: 89,503,663	Q317K	probably benign	Het
Slc22a17	A	G	14: 54,907,990	V460A	probably damaging	Het
Slc39a11	G	T	11: 113,559,535	D41E	probably damaging	Het
Spag17	T	C	3: 99,939,363	S68P	possibly damaging	Het
Sstr5	C	T	17: 25,491,298	C319Y	possibly damaging	Het
Stk17b	G	T	1: 53,757,590	D339E	probably damaging	Het
Tagln2	A	G	1: 172,505,221	D25G	probably benign	Het
Ttn	C	T	2: 76,794,850	V13417I	probably benign	Het
Vps50	A	G	6: 3,545,568	E334G	possibly damaging	Het
Zfp316	T	C	5: 143,264,094	E138G	unknown	Het
Zfp879	T	A	11: 50,833,549	T227S	probably benign	Het

Other mutations in Inpp5d

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00323:Inpp5d	APN	1	87683815	missense	probably benign	0.00
IGL00329:Inpp5d	APN	1	87668003	missense	probably benign	0.00
IGL00897:Inpp5d	APN	1	87712114	missense	probably benign	0.14
IGL01314:Inpp5d	APN	1	87683750	nonsense	probably null
IGL02145:Inpp5d	APN	1	87715055	missense	probably damaging	1.00
IGL02422:Inpp5d	APN	1	87708132	missense	probably damaging	1.00
IGL02538:Inpp5d	APN	1	87695366	missense	probably null	0.92
IGL02680:Inpp5d	APN	1	87701483	missense	possibly damaging	0.87
IGL03083:Inpp5d	APN	1	87711141	missense	probably damaging	1.00
IGL03308:Inpp5d	APN	1	87703197	missense	probably damaging	1.00
americas	UTSW	1	87715142	missense	probably damaging	1.00
Apfelsine	UTSW	1	87683845	nonsense	probably null
Auburn	UTSW	1	87681680	splice site	probably null
Autumnal	UTSW	1	87691711	missense	probably damaging	0.97
Gourd	UTSW	1	87697615	intron	probably benign
lyda	UTSW	1	87683762	missense	probably damaging	1.00
Mandarin	UTSW	1	87709626	missense	probably damaging	0.99
naranjo	UTSW	1	87708211	critical splice donor site	probably null
New_black	UTSW	1	87709675	missense	probably damaging	1.00
Orange	UTSW	1	87697546	critical splice donor site	probably null
pantone	UTSW	1	87699675	missense	probably damaging	1.00
sailing	UTSW	1	87705964	missense	probably damaging	1.00
Salamander	UTSW	1	87695380	missense	probably damaging	0.99
Sandstone	UTSW	1	87695400	missense	probably damaging	1.00
styx	UTSW	1	87669784	critical splice donor site	probably benign
tangerine	UTSW	1	87705949	missense	probably damaging	1.00
ulster	UTSW	1	87701476	nonsense	probably null
R0010:Inpp5d	UTSW	1	87697546	critical splice donor site	probably null
R0037:Inpp5d	UTSW	1	87708129	missense	probably damaging	0.99
R0087:Inpp5d	UTSW	1	87715138	missense	probably damaging	1.00
R0492:Inpp5d	UTSW	1	87698150	missense	possibly damaging	0.94
R0520:Inpp5d	UTSW	1	87705920	splice site	probably benign
R0733:Inpp5d	UTSW	1	87668077	splice site	probably benign
R1464:Inpp5d	UTSW	1	87698105	splice site	probably benign
R1576:Inpp5d	UTSW	1	87669685	missense	probably benign	0.16
R1592:Inpp5d	UTSW	1	87665532	missense	possibly damaging	0.90
R1750:Inpp5d	UTSW	1	87699081	missense	probably damaging	1.00
R1774:Inpp5d	UTSW	1	87667889	missense	probably benign	0.30
R1972:Inpp5d	UTSW	1	87676314	missense	probably benign	0.00
R2024:Inpp5d	UTSW	1	87695350	nonsense	probably null
R2405:Inpp5d	UTSW	1	87699729	missense	possibly damaging	0.94
R3412:Inpp5d	UTSW	1	87668057	missense	possibly damaging	0.93
R3414:Inpp5d	UTSW	1	87668057	missense	possibly damaging	0.93
R3756:Inpp5d	UTSW	1	87701408	splice site	probably benign
R4652:Inpp5d	UTSW	1	87665451	missense	probably benign	0.03
R4676:Inpp5d	UTSW	1	87715142	missense	probably damaging	1.00
R4834:Inpp5d	UTSW	1	87697523	missense	possibly damaging	0.52
R5086:Inpp5d	UTSW	1	87705964	missense	probably damaging	1.00
R5159:Inpp5d	UTSW	1	87676342	missense	probably damaging	1.00
R5250:Inpp5d	UTSW	1	87709675	missense	probably damaging	1.00
R5442:Inpp5d	UTSW	1	87718066	missense	probably benign	0.02
R5875:Inpp5d	UTSW	1	87717974	missense	possibly damaging	0.47
R6135:Inpp5d	UTSW	1	87620397	splice site	probably null
R6371:Inpp5d	UTSW	1	87699675	missense	probably damaging	1.00
R6385:Inpp5d	UTSW	1	87699675	missense	probably damaging	1.00
R6386:Inpp5d	UTSW	1	87699675	missense	probably damaging	1.00
R6526:Inpp5d	UTSW	1	87676250	start gained	probably benign
R6572:Inpp5d	UTSW	1	87695396	missense	probably damaging	0.99
R6831:Inpp5d	UTSW	1	87701476	nonsense	probably null
R6853:Inpp5d	UTSW	1	87681680	splice site	probably null
R6883:Inpp5d	UTSW	1	87699690	missense	probably damaging	0.98
R7082:Inpp5d	UTSW	1	87695380	missense	probably damaging	0.99
R7215:Inpp5d	UTSW	1	87701218	missense	probably benign	0.30
R7418:Inpp5d	UTSW	1	87708211	critical splice donor site	probably null
R7471:Inpp5d	UTSW	1	87695400	missense	probably damaging	1.00
R7593:Inpp5d	UTSW	1	87717778	missense	possibly damaging	0.82
R7716:Inpp5d	UTSW	1	87665399	missense	probably damaging	0.97
R7781:Inpp5d	UTSW	1	87699672	missense	probably damaging	1.00
R7808:Inpp5d	UTSW	1	87683845	nonsense	probably null
R7920:Inpp5d	UTSW	1	87705949	missense	probably damaging	1.00
R8788:Inpp5d	UTSW	1	87683762	missense	probably damaging	1.00
R8839:Inpp5d	UTSW	1	87691711	missense	probably damaging	0.97
R8905:Inpp5d	UTSW	1	87709626	missense	probably damaging	0.99
R8906:Inpp5d	UTSW	1	87697615	intron	probably benign
R9517:Inpp5d	UTSW	1	87711131	missense	probably benign	0.01
R9667:Inpp5d	UTSW	1	87695406	missense	probably damaging	1.00
R9716:Inpp5d	UTSW	1	87697469	missense	possibly damaging	0.90
Z1176:Inpp5d	UTSW	1	87669709	missense	probably benign	0.16
Z1176:Inpp5d	UTSW	1	87703131	missense	probably damaging	1.00
Z1191:Inpp5d	UTSW	1	87683770	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- GACGGCCCCAGAGATTTTAAGGAC -3'
(R):5'- TTGGTAGATTCTGAGCCCTCGTGC -3'

Sequencing Primer
(F):5'- CCCAGAGATTTTAAGGACTGTGTAGG -3'
(R):5'- CAGCAAGGACTTGACCTGTG -3'

Posted On

2014-04-13