Incidental Mutation 'R1576:Fh1'
ID171146
Institutional Source Beutler Lab
Gene Symbol Fh1
Ensembl Gene ENSMUSG00000026526
Gene Namefumarate hydratase 1
Synonymsfumarase
MMRRC Submission 039614-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1576 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location175600374-175625635 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 175607819 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 366 (P366L)
Ref Sequence ENSEMBL: ENSMUSP00000027810 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027810]
Predicted Effect probably null
Transcript: ENSMUST00000027810
AA Change: P366L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000027810
Gene: ENSMUSG00000026526
AA Change: P366L

DomainStartEndE-ValueType
low complexity region 3 16 N/A INTRINSIC
Pfam:Lyase_1 55 386 1.8e-124 PFAM
Pfam:FumaraseC_C 452 505 2.5e-29 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130996
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133218
Predicted Effect probably benign
Transcript: ENSMUST00000176740
Meta Mutation Damage Score 0.9752 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 92.1%
Validation Efficiency 100% (49/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an enzymatic component of the tricarboxylic acid (TCA) cycle, or Krebs cycle, and catalyzes the formation of L-malate from fumarate. It exists in both a cytosolic form and an N-terminal extended form, differing only in the translation start site used. The N-terminal extended form is targeted to the mitochondrion, where the removal of the extension generates the same form as in the cytoplasm. It is similar to some thermostable class II fumarases and functions as a homotetramer. Mutations in this gene can cause fumarase deficiency and lead to progressive encephalopathy. [provided by RefSeq, Jul 2008]
PHENOTYPE: Embryos homozygous for a knock-out allele fail to develop past the egg-cylinder stage and die at E6.0. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ap3m2 G A 8: 22,808,467 probably benign Het
Apol11a T A 15: 77,516,931 I206N probably damaging Het
Arfgap3 A G 15: 83,313,563 S331P possibly damaging Het
Arhgef16 A C 4: 154,291,312 L75R probably damaging Het
Cfi T C 3: 129,873,050 V474A probably damaging Het
Dhx8 T C 11: 101,752,319 V739A probably damaging Het
Dpy19l2 T A 9: 24,584,502 H640L probably benign Het
Eif4g3 T A 4: 138,096,870 M57K probably damaging Het
Emilin2 A G 17: 71,255,117 probably null Het
Epc1 T C 18: 6,452,366 E281G possibly damaging Het
Fancd2 G T 6: 113,578,405 S1125I probably damaging Het
Gata3 A T 2: 9,863,196 S316T probably damaging Het
Hmcn1 A T 1: 150,657,241 S3064T possibly damaging Het
Inpp5d A T 1: 87,669,685 T193S probably benign Het
Inpp5d A T 1: 87,681,558 I277F probably damaging Het
Itga5 T C 15: 103,351,617 D616G probably damaging Het
Jade1 T A 3: 41,591,807 V89E probably damaging Het
Lamb2 T C 9: 108,480,307 S81P probably damaging Het
Lrrc19 G A 4: 94,639,353 P207L probably damaging Het
Maea A G 5: 33,362,696 D147G probably damaging Het
Muc6 T A 7: 141,634,524 E2767V possibly damaging Het
Myom2 A G 8: 15,084,556 Y453C probably damaging Het
Naip2 A T 13: 100,155,021 D1136E probably benign Het
Naip2 G A 13: 100,155,029 probably benign Het
Nap1l1 A G 10: 111,494,820 D362G probably damaging Het
Nap1l4 C T 7: 143,538,216 probably null Het
Nudt21 A C 8: 94,028,833 probably null Het
Nufip1 A G 14: 76,134,870 N475D probably benign Het
Pcdhb8 A G 18: 37,356,703 D478G probably damaging Het
Pla2g4d A G 2: 120,284,167 S28P probably damaging Het
Polr2j C A 5: 136,120,028 N29K probably damaging Het
Ppp2r2a A G 14: 67,038,869 probably benign Het
Ptprk A G 10: 28,551,651 D742G probably damaging Het
Pum2 A G 12: 8,713,524 D227G probably benign Het
Rfxank C A 8: 70,134,303 R221L possibly damaging Het
Shank3 C A 15: 89,503,663 Q317K probably benign Het
Slc22a17 A G 14: 54,907,990 V460A probably damaging Het
Slc39a11 G T 11: 113,559,535 D41E probably damaging Het
Spag17 T C 3: 99,939,363 S68P possibly damaging Het
Sstr5 C T 17: 25,491,298 C319Y possibly damaging Het
Stk17b G T 1: 53,757,590 D339E probably damaging Het
Tagln2 A G 1: 172,505,221 D25G probably benign Het
Ttn C T 2: 76,794,850 V13417I probably benign Het
Vps50 A G 6: 3,545,568 E334G possibly damaging Het
Zfp316 T C 5: 143,264,094 E138G unknown Het
Zfp879 T A 11: 50,833,549 T227S probably benign Het
Other mutations in Fh1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01723:Fh1 APN 1 175601542 missense probably damaging 1.00
IGL02637:Fh1 APN 1 175609766 missense probably benign 0.00
IGL02954:Fh1 APN 1 175609735 missense probably damaging 1.00
IGL03056:Fh1 APN 1 175606162 missense probably damaging 1.00
IGL03309:Fh1 APN 1 175604043 missense probably benign 0.01
R0729:Fh1 UTSW 1 175614817 missense probably damaging 1.00
R1240:Fh1 UTSW 1 175604015 missense probably damaging 1.00
R1327:Fh1 UTSW 1 175609744 missense probably benign 0.32
R1779:Fh1 UTSW 1 175601424 makesense probably null
R1823:Fh1 UTSW 1 175616548 missense probably damaging 1.00
R1851:Fh1 UTSW 1 175607886 missense probably damaging 1.00
R1943:Fh1 UTSW 1 175609778 missense probably benign
R2163:Fh1 UTSW 1 175614840 missense possibly damaging 0.80
R3766:Fh1 UTSW 1 175614750 missense probably damaging 1.00
R4193:Fh1 UTSW 1 175614841 missense possibly damaging 0.51
R4672:Fh1 UTSW 1 175604051 missense probably benign 0.07
R4812:Fh1 UTSW 1 175601459 missense probably damaging 0.99
R4849:Fh1 UTSW 1 175620506 missense probably benign 0.00
R4905:Fh1 UTSW 1 175619073 missense probably damaging 1.00
R4978:Fh1 UTSW 1 175603967 missense probably damaging 1.00
R6645:Fh1 UTSW 1 175614876 missense possibly damaging 0.94
R6681:Fh1 UTSW 1 175619124 missense probably null 0.71
R7075:Fh1 UTSW 1 175607855 missense probably benign 0.00
R7646:Fh1 UTSW 1 175614913 missense probably benign 0.03
R7783:Fh1 UTSW 1 175612178 missense probably damaging 1.00
R7862:Fh1 UTSW 1 175614834 missense probably damaging 0.97
R7991:Fh1 UTSW 1 175609771 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCTCTAGTGTTTGCCACTCTGAC -3'
(R):5'- TGCCCCGAATAAGTTTGAAGCTCTG -3'

Sequencing Primer
(F):5'- TATGGAACTCCACCAGGCTG -3'
(R):5'- AATAAGTTTGAAGCTCTGGCTGC -3'
Posted On2014-04-13