Incidental Mutation 'R1576:Gata3'
ID171147
Institutional Source Beutler Lab
Gene Symbol Gata3
Ensembl Gene ENSMUSG00000015619
Gene NameGATA binding protein 3
SynonymsGata-3, jal
MMRRC Submission 039614-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1576 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location9857078-9890034 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 9863196 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 316 (S316T)
Ref Sequence ENSEMBL: ENSMUSP00000100041 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102976]
PDB Structure
Adjacent GATA DNA binding [X-RAY DIFFRACTION]
Opposite GATA DNA binding [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000102976
AA Change: S316T

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000100041
Gene: ENSMUSG00000015619
AA Change: S316T

DomainStartEndE-ValueType
low complexity region 128 149 N/A INTRINSIC
low complexity region 153 165 N/A INTRINSIC
low complexity region 229 247 N/A INTRINSIC
ZnF_GATA 257 307 3.65e-20 SMART
ZnF_GATA 311 361 2.9e-23 SMART
low complexity region 367 377 N/A INTRINSIC
low complexity region 399 425 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151456
Meta Mutation Damage Score 0.1285 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 92.1%
Validation Efficiency 100% (49/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which belongs to the GATA family of transcription factors. The protein contains two GATA-type zinc fingers and is an important regulator of T-cell development and plays an important role in endothelial cell biology. Defects in this gene are the cause of hypoparathyroidism with sensorineural deafness and renal dysplasia. [provided by RefSeq, Nov 2009]
PHENOTYPE: Homozygous inactivation is embryonic lethal and show a variety of embryonic defects. T cell development is impaired when the locus is conditionally. Mice with a spontaneous mutation exhibit partial hair loss and various defects in hair structure and in hair growth cycle regulation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ap3m2 G A 8: 22,808,467 probably benign Het
Apol11a T A 15: 77,516,931 I206N probably damaging Het
Arfgap3 A G 15: 83,313,563 S331P possibly damaging Het
Arhgef16 A C 4: 154,291,312 L75R probably damaging Het
Cfi T C 3: 129,873,050 V474A probably damaging Het
Dhx8 T C 11: 101,752,319 V739A probably damaging Het
Dpy19l2 T A 9: 24,584,502 H640L probably benign Het
Eif4g3 T A 4: 138,096,870 M57K probably damaging Het
Emilin2 A G 17: 71,255,117 probably null Het
Epc1 T C 18: 6,452,366 E281G possibly damaging Het
Fancd2 G T 6: 113,578,405 S1125I probably damaging Het
Fh1 G A 1: 175,607,819 P366L probably null Het
Hmcn1 A T 1: 150,657,241 S3064T possibly damaging Het
Inpp5d A T 1: 87,669,685 T193S probably benign Het
Inpp5d A T 1: 87,681,558 I277F probably damaging Het
Itga5 T C 15: 103,351,617 D616G probably damaging Het
Jade1 T A 3: 41,591,807 V89E probably damaging Het
Lamb2 T C 9: 108,480,307 S81P probably damaging Het
Lrrc19 G A 4: 94,639,353 P207L probably damaging Het
Maea A G 5: 33,362,696 D147G probably damaging Het
Muc6 T A 7: 141,634,524 E2767V possibly damaging Het
Myom2 A G 8: 15,084,556 Y453C probably damaging Het
Naip2 A T 13: 100,155,021 D1136E probably benign Het
Naip2 G A 13: 100,155,029 probably benign Het
Nap1l1 A G 10: 111,494,820 D362G probably damaging Het
Nap1l4 C T 7: 143,538,216 probably null Het
Nudt21 A C 8: 94,028,833 probably null Het
Nufip1 A G 14: 76,134,870 N475D probably benign Het
Pcdhb8 A G 18: 37,356,703 D478G probably damaging Het
Pla2g4d A G 2: 120,284,167 S28P probably damaging Het
Polr2j C A 5: 136,120,028 N29K probably damaging Het
Ppp2r2a A G 14: 67,038,869 probably benign Het
Ptprk A G 10: 28,551,651 D742G probably damaging Het
Pum2 A G 12: 8,713,524 D227G probably benign Het
Rfxank C A 8: 70,134,303 R221L possibly damaging Het
Shank3 C A 15: 89,503,663 Q317K probably benign Het
Slc22a17 A G 14: 54,907,990 V460A probably damaging Het
Slc39a11 G T 11: 113,559,535 D41E probably damaging Het
Spag17 T C 3: 99,939,363 S68P possibly damaging Het
Sstr5 C T 17: 25,491,298 C319Y possibly damaging Het
Stk17b G T 1: 53,757,590 D339E probably damaging Het
Tagln2 A G 1: 172,505,221 D25G probably benign Het
Ttn C T 2: 76,794,850 V13417I probably benign Het
Vps50 A G 6: 3,545,568 E334G possibly damaging Het
Zfp316 T C 5: 143,264,094 E138G unknown Het
Zfp879 T A 11: 50,833,549 T227S probably benign Het
Other mutations in Gata3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01366:Gata3 APN 2 9877465 missense probably damaging 1.00
IGL03168:Gata3 APN 2 9868814 missense probably damaging 1.00
R0054:Gata3 UTSW 2 9858447 missense probably damaging 1.00
R0123:Gata3 UTSW 2 9874809 missense probably benign 0.11
R0225:Gata3 UTSW 2 9874809 missense probably benign 0.11
R0724:Gata3 UTSW 2 9874575 missense probably benign
R1491:Gata3 UTSW 2 9877390 missense probably damaging 0.96
R1608:Gata3 UTSW 2 9874768 nonsense probably null
R1667:Gata3 UTSW 2 9877549 missense possibly damaging 0.95
R3119:Gata3 UTSW 2 9877585 critical splice acceptor site probably null
R3753:Gata3 UTSW 2 9868840 missense probably benign 0.39
R3876:Gata3 UTSW 2 9863143 missense probably damaging 1.00
R5040:Gata3 UTSW 2 9858515 missense probably damaging 1.00
R5292:Gata3 UTSW 2 9868874 missense probably damaging 1.00
R6414:Gata3 UTSW 2 9858434 missense possibly damaging 0.95
R6696:Gata3 UTSW 2 9874492 nonsense probably null
R6848:Gata3 UTSW 2 9858528 missense possibly damaging 0.88
R7580:Gata3 UTSW 2 9863132 missense probably damaging 1.00
R7900:Gata3 UTSW 2 9858650 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCCAAGGAAGGTGACTGAAACCC -3'
(R):5'- GACCTTGATGACTTTCATGTGGCCC -3'

Sequencing Primer
(F):5'- GGTGACTGAAACCCATCAGAAATC -3'
(R):5'- CAGTCTTCATAGCTCTGCCA -3'
Posted On2014-04-13