Mutagenetix > Incidental Mutation

Incidental Mutation 'R1576:Gata3'

171147

Institutional Source

Beutler Lab

Gene Symbol

Gata3

Ensembl Gene

ENSMUSG00000015619

Gene Name

GATA binding protein 3

Synonyms

jal, Gata-3

MMRRC Submission

039614-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R1576 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

9861889-9894845 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 9868007 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Serine to Threonine at position 316 (S316T)

Ref Sequence

ENSEMBL: ENSMUSP00000100041 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000102976]

AlphaFold

P23772

PDB Structure

Adjacent GATA DNA binding [X-RAY DIFFRACTION]
Opposite GATA DNA binding [X-RAY DIFFRACTION]

Predicted Effect

probably damaging
Transcript: ENSMUST00000102976
AA Change: S316T

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000100041
Gene: ENSMUSG00000015619
AA Change: S316T

Domain	Start	End	E-Value	Type
low complexity region	128	149	N/A	INTRINSIC
low complexity region	153	165	N/A	INTRINSIC
low complexity region	229	247	N/A	INTRINSIC
ZnF_GATA	257	307	3.65e-20	SMART
ZnF_GATA	311	361	2.9e-23	SMART
low complexity region	367	377	N/A	INTRINSIC
low complexity region	399	425	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000151456

Meta Mutation Damage Score

0.1285

Coding Region Coverage

1x: 99.1%
3x: 98.2%
10x: 96.0%
20x: 92.1%

Validation Efficiency

100% (49/49)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which belongs to the GATA family of transcription factors. The protein contains two GATA-type zinc fingers and is an important regulator of T-cell development and plays an important role in endothelial cell biology. Defects in this gene are the cause of hypoparathyroidism with sensorineural deafness and renal dysplasia. [provided by RefSeq, Nov 2009]
PHENOTYPE: Homozygous inactivation is embryonic lethal and show a variety of embryonic defects. T cell development is impaired when the locus is conditionally. Mice with a spontaneous mutation exhibit partial hair loss and various defects in hair structure and in hair growth cycle regulation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 46 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ap3m2	G	A	8: 23,298,483 (GRCm39)		probably benign	Het
Apol11a	T	A	15: 77,401,131 (GRCm39)	I206N	probably damaging	Het
Arfgap3	A	G	15: 83,197,764 (GRCm39)	S331P	possibly damaging	Het
Arhgef16	A	C	4: 154,375,769 (GRCm39)	L75R	probably damaging	Het
Cfi	T	C	3: 129,666,699 (GRCm39)	V474A	probably damaging	Het
Dhx8	T	C	11: 101,643,145 (GRCm39)	V739A	probably damaging	Het
Dpy19l2	T	A	9: 24,495,798 (GRCm39)	H640L	probably benign	Het
Eif4g3	T	A	4: 137,824,181 (GRCm39)	M57K	probably damaging	Het
Emilin2	A	G	17: 71,562,112 (GRCm39)		probably null	Het
Epc1	T	C	18: 6,452,366 (GRCm39)	E281G	possibly damaging	Het
Fancd2	G	T	6: 113,555,366 (GRCm39)	S1125I	probably damaging	Het
Fh1	G	A	1: 175,435,385 (GRCm39)	P366L	probably null	Het
Hmcn1	A	T	1: 150,532,992 (GRCm39)	S3064T	possibly damaging	Het
Inpp5d	A	T	1: 87,597,407 (GRCm39)	T193S	probably benign	Het
Inpp5d	A	T	1: 87,609,280 (GRCm39)	I277F	probably damaging	Het
Itga5	T	C	15: 103,260,044 (GRCm39)	D616G	probably damaging	Het
Jade1	T	A	3: 41,546,242 (GRCm39)	V89E	probably damaging	Het
Lamb2	T	C	9: 108,357,506 (GRCm39)	S81P	probably damaging	Het
Lrrc19	G	A	4: 94,527,590 (GRCm39)	P207L	probably damaging	Het
Maea	A	G	5: 33,520,040 (GRCm39)	D147G	probably damaging	Het
Muc6	T	A	7: 141,214,437 (GRCm39)	E2767V	possibly damaging	Het
Myom2	A	G	8: 15,134,556 (GRCm39)	Y453C	probably damaging	Het
Naip2	G	A	13: 100,291,537 (GRCm39)		probably benign	Het
Naip2	A	T	13: 100,291,529 (GRCm39)	D1136E	probably benign	Het
Nap1l1	A	G	10: 111,330,681 (GRCm39)	D362G	probably damaging	Het
Nap1l4	C	T	7: 143,091,953 (GRCm39)		probably null	Het
Nudt21	A	C	8: 94,755,461 (GRCm39)		probably null	Het
Nufip1	A	G	14: 76,372,310 (GRCm39)	N475D	probably benign	Het
Pcdhb8	A	G	18: 37,489,756 (GRCm39)	D478G	probably damaging	Het
Pla2g4d	A	G	2: 120,114,648 (GRCm39)	S28P	probably damaging	Het
Polr2j	C	A	5: 136,148,882 (GRCm39)	N29K	probably damaging	Het
Ppp2r2a	A	G	14: 67,276,318 (GRCm39)		probably benign	Het
Ptprk	A	G	10: 28,427,647 (GRCm39)	D742G	probably damaging	Het
Pum2	A	G	12: 8,763,524 (GRCm39)	D227G	probably benign	Het
Rfxank	C	A	8: 70,586,953 (GRCm39)	R221L	possibly damaging	Het
Shank3	C	A	15: 89,387,866 (GRCm39)	Q317K	probably benign	Het
Slc22a17	A	G	14: 55,145,447 (GRCm39)	V460A	probably damaging	Het
Slc39a11	G	T	11: 113,450,361 (GRCm39)	D41E	probably damaging	Het
Spag17	T	C	3: 99,846,679 (GRCm39)	S68P	possibly damaging	Het
Sstr5	C	T	17: 25,710,272 (GRCm39)	C319Y	possibly damaging	Het
Stk17b	G	T	1: 53,796,749 (GRCm39)	D339E	probably damaging	Het
Tagln2	A	G	1: 172,332,788 (GRCm39)	D25G	probably benign	Het
Ttn	C	T	2: 76,625,194 (GRCm39)	V13417I	probably benign	Het
Vps50	A	G	6: 3,545,568 (GRCm39)	E334G	possibly damaging	Het
Zfp316	T	C	5: 143,249,849 (GRCm39)	E138G	unknown	Het
Zfp879	T	A	11: 50,724,376 (GRCm39)	T227S	probably benign	Het

Other mutations in Gata3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01366:Gata3	APN	2	9,882,276 (GRCm39)	missense	probably damaging	1.00
IGL03168:Gata3	APN	2	9,873,625 (GRCm39)	missense	probably damaging	1.00
R0054:Gata3	UTSW	2	9,863,258 (GRCm39)	missense	probably damaging	1.00
R0123:Gata3	UTSW	2	9,879,620 (GRCm39)	missense	probably benign	0.11
R0225:Gata3	UTSW	2	9,879,620 (GRCm39)	missense	probably benign	0.11
R0724:Gata3	UTSW	2	9,879,386 (GRCm39)	missense	probably benign
R1491:Gata3	UTSW	2	9,882,201 (GRCm39)	missense	probably damaging	0.96
R1608:Gata3	UTSW	2	9,879,579 (GRCm39)	nonsense	probably null
R1667:Gata3	UTSW	2	9,882,360 (GRCm39)	missense	possibly damaging	0.95
R3119:Gata3	UTSW	2	9,882,396 (GRCm39)	critical splice acceptor site	probably null
R3753:Gata3	UTSW	2	9,873,651 (GRCm39)	missense	probably benign	0.39
R3876:Gata3	UTSW	2	9,867,954 (GRCm39)	missense	probably damaging	1.00
R5040:Gata3	UTSW	2	9,863,326 (GRCm39)	missense	probably damaging	1.00
R5292:Gata3	UTSW	2	9,873,685 (GRCm39)	missense	probably damaging	1.00
R6414:Gata3	UTSW	2	9,863,245 (GRCm39)	missense	possibly damaging	0.95
R6696:Gata3	UTSW	2	9,879,303 (GRCm39)	nonsense	probably null
R6848:Gata3	UTSW	2	9,863,339 (GRCm39)	missense	possibly damaging	0.88
R7580:Gata3	UTSW	2	9,867,943 (GRCm39)	missense	probably damaging	1.00
R7900:Gata3	UTSW	2	9,863,461 (GRCm39)	missense	probably damaging	1.00
R8551:Gata3	UTSW	2	9,867,994 (GRCm39)	missense	probably damaging	1.00
R9602:Gata3	UTSW	2	9,863,297 (GRCm39)	missense	possibly damaging	0.86
R9775:Gata3	UTSW	2	9,863,197 (GRCm39)	missense	possibly damaging	0.94

Predicted Primers

PCR Primer
(F):5'- CTCCAAGGAAGGTGACTGAAACCC -3'
(R):5'- GACCTTGATGACTTTCATGTGGCCC -3'

Sequencing Primer
(F):5'- GGTGACTGAAACCCATCAGAAATC -3'
(R):5'- CAGTCTTCATAGCTCTGCCA -3'

Posted On

2014-04-13