Incidental Mutation 'R1576:Pla2g4d'
ID171149
Institutional Source Beutler Lab
Gene Symbol Pla2g4d
Ensembl Gene ENSMUSG00000070719
Gene Namephospholipase A2, group IVD
SynonymsPla2delta, 2610311B01Rik
MMRRC Submission 039614-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #R1576 (G1)
Quality Score161
Status Validated
Chromosome2
Chromosomal Location120265595-120289197 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 120284167 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 28 (S28P)
Ref Sequence ENSEMBL: ENSMUSP00000092252 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094665]
Predicted Effect probably damaging
Transcript: ENSMUST00000094665
AA Change: S28P

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000092252
Gene: ENSMUSG00000070719
AA Change: S28P

DomainStartEndE-ValueType
C2 32 132 1.12e-18 SMART
PLAc 263 766 3.36e-11 SMART
Meta Mutation Damage Score 0.2774 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 92.1%
Validation Efficiency 100% (49/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The phospholipase A2 enzyme family, including PLA2G4D, catalyze the hydrolysis of glycerophospholipids at the sn-2 position and then liberate free fatty acids and lysophospholipids (Chiba et al., 2004 [PubMed 14709560]).[supplied by OMIM, Jun 2009]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ap3m2 G A 8: 22,808,467 probably benign Het
Apol11a T A 15: 77,516,931 I206N probably damaging Het
Arfgap3 A G 15: 83,313,563 S331P possibly damaging Het
Arhgef16 A C 4: 154,291,312 L75R probably damaging Het
Cfi T C 3: 129,873,050 V474A probably damaging Het
Dhx8 T C 11: 101,752,319 V739A probably damaging Het
Dpy19l2 T A 9: 24,584,502 H640L probably benign Het
Eif4g3 T A 4: 138,096,870 M57K probably damaging Het
Emilin2 A G 17: 71,255,117 probably null Het
Epc1 T C 18: 6,452,366 E281G possibly damaging Het
Fancd2 G T 6: 113,578,405 S1125I probably damaging Het
Fh1 G A 1: 175,607,819 P366L probably null Het
Gata3 A T 2: 9,863,196 S316T probably damaging Het
Hmcn1 A T 1: 150,657,241 S3064T possibly damaging Het
Inpp5d A T 1: 87,669,685 T193S probably benign Het
Inpp5d A T 1: 87,681,558 I277F probably damaging Het
Itga5 T C 15: 103,351,617 D616G probably damaging Het
Jade1 T A 3: 41,591,807 V89E probably damaging Het
Lamb2 T C 9: 108,480,307 S81P probably damaging Het
Lrrc19 G A 4: 94,639,353 P207L probably damaging Het
Maea A G 5: 33,362,696 D147G probably damaging Het
Muc6 T A 7: 141,634,524 E2767V possibly damaging Het
Myom2 A G 8: 15,084,556 Y453C probably damaging Het
Naip2 A T 13: 100,155,021 D1136E probably benign Het
Naip2 G A 13: 100,155,029 probably benign Het
Nap1l1 A G 10: 111,494,820 D362G probably damaging Het
Nap1l4 C T 7: 143,538,216 probably null Het
Nudt21 A C 8: 94,028,833 probably null Het
Nufip1 A G 14: 76,134,870 N475D probably benign Het
Pcdhb8 A G 18: 37,356,703 D478G probably damaging Het
Polr2j C A 5: 136,120,028 N29K probably damaging Het
Ppp2r2a A G 14: 67,038,869 probably benign Het
Ptprk A G 10: 28,551,651 D742G probably damaging Het
Pum2 A G 12: 8,713,524 D227G probably benign Het
Rfxank C A 8: 70,134,303 R221L possibly damaging Het
Shank3 C A 15: 89,503,663 Q317K probably benign Het
Slc22a17 A G 14: 54,907,990 V460A probably damaging Het
Slc39a11 G T 11: 113,559,535 D41E probably damaging Het
Spag17 T C 3: 99,939,363 S68P possibly damaging Het
Sstr5 C T 17: 25,491,298 C319Y possibly damaging Het
Stk17b G T 1: 53,757,590 D339E probably damaging Het
Tagln2 A G 1: 172,505,221 D25G probably benign Het
Ttn C T 2: 76,794,850 V13417I probably benign Het
Vps50 A G 6: 3,545,568 E334G possibly damaging Het
Zfp316 T C 5: 143,264,094 E138G unknown Het
Zfp879 T A 11: 50,833,549 T227S probably benign Het
Other mutations in Pla2g4d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01295:Pla2g4d APN 2 120281726 missense probably damaging 1.00
IGL01405:Pla2g4d APN 2 120266823 missense probably benign 0.01
IGL01642:Pla2g4d APN 2 120280636 missense probably damaging 1.00
IGL01657:Pla2g4d APN 2 120275287 missense possibly damaging 0.91
BB001:Pla2g4d UTSW 2 120289164 start gained probably benign
R0962:Pla2g4d UTSW 2 120280617 critical splice donor site probably null
R1564:Pla2g4d UTSW 2 120268903 missense possibly damaging 0.76
R1667:Pla2g4d UTSW 2 120270150 splice site probably benign
R1680:Pla2g4d UTSW 2 120277750 critical splice donor site probably null
R1712:Pla2g4d UTSW 2 120277490 missense possibly damaging 0.51
R2253:Pla2g4d UTSW 2 120271141 missense probably damaging 0.99
R2919:Pla2g4d UTSW 2 120281627 splice site probably benign
R3122:Pla2g4d UTSW 2 120278903 missense probably benign 0.03
R4420:Pla2g4d UTSW 2 120284163 missense probably benign
R4737:Pla2g4d UTSW 2 120266790 missense probably benign 0.00
R4829:Pla2g4d UTSW 2 120266743 missense probably damaging 1.00
R5032:Pla2g4d UTSW 2 120281695 nonsense probably null
R5530:Pla2g4d UTSW 2 120269555 missense probably benign 0.06
R5677:Pla2g4d UTSW 2 120278948 missense possibly damaging 0.87
R6087:Pla2g4d UTSW 2 120270006 missense probably damaging 1.00
R6088:Pla2g4d UTSW 2 120270006 missense probably damaging 1.00
R6150:Pla2g4d UTSW 2 120269564 missense probably damaging 1.00
R6930:Pla2g4d UTSW 2 120270633 missense probably damaging 1.00
R7240:Pla2g4d UTSW 2 120270349 missense probably damaging 1.00
R7284:Pla2g4d UTSW 2 120284136 missense probably damaging 1.00
R7339:Pla2g4d UTSW 2 120278978 missense probably benign
R7552:Pla2g4d UTSW 2 120284139 missense possibly damaging 0.56
R7607:Pla2g4d UTSW 2 120288976 missense probably benign
R7692:Pla2g4d UTSW 2 120279295 missense possibly damaging 0.84
R7860:Pla2g4d UTSW 2 120266730 missense probably benign 0.13
R7924:Pla2g4d UTSW 2 120289164 start gained probably benign
R7972:Pla2g4d UTSW 2 120278932 missense probably benign 0.04
R8373:Pla2g4d UTSW 2 120277499 missense probably null 1.00
X0026:Pla2g4d UTSW 2 120277471 missense probably damaging 0.99
X0028:Pla2g4d UTSW 2 120281726 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGACAACCCCAGTATCCCCTGAG -3'
(R):5'- TCGAGAGTAGGCTGTGCCAACAAG -3'

Sequencing Primer
(F):5'- GTATCCCCTGAGAGCAGCTAAG -3'
(R):5'- AATTGAGATTCTGTCCCTCAATCAC -3'
Posted On2014-04-13