Incidental Mutation 'R1576:Jade1'
ID171150
Institutional Source Beutler Lab
Gene Symbol Jade1
Ensembl Gene ENSMUSG00000025764
Gene Namejade family PHD finger 1
SynonymsD530048A03Rik, Phf17
MMRRC Submission 039614-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1576 (G1)
Quality Score155
Status Validated
Chromosome3
Chromosomal Location41555731-41616864 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 41591807 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 89 (V89E)
Ref Sequence ENSEMBL: ENSMUSP00000141670 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026865] [ENSMUST00000163764] [ENSMUST00000168086] [ENSMUST00000170711] [ENSMUST00000191952] [ENSMUST00000194181] [ENSMUST00000195846]
Predicted Effect probably damaging
Transcript: ENSMUST00000026865
AA Change: V89E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000026865
Gene: ENSMUSG00000025764
AA Change: V89E

DomainStartEndE-ValueType
Pfam:EPL1 31 182 5.3e-23 PFAM
PHD 206 252 1.91e-10 SMART
PHD 315 370 1.31e-8 SMART
low complexity region 622 634 N/A INTRINSIC
low complexity region 817 831 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000163764
AA Change: V89E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000128152
Gene: ENSMUSG00000025764
AA Change: V89E

DomainStartEndE-ValueType
Pfam:EPL1 31 182 5.3e-23 PFAM
PHD 206 252 1.91e-10 SMART
PHD 315 370 1.31e-8 SMART
low complexity region 622 634 N/A INTRINSIC
low complexity region 817 831 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000168086
AA Change: V89E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000131441
Gene: ENSMUSG00000025764
AA Change: V89E

DomainStartEndE-ValueType
Pfam:EPL1 31 182 5.3e-23 PFAM
PHD 206 252 1.91e-10 SMART
PHD 315 370 1.31e-8 SMART
low complexity region 622 634 N/A INTRINSIC
low complexity region 817 831 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000170711
AA Change: V89E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000127113
Gene: ENSMUSG00000025764
AA Change: V89E

DomainStartEndE-ValueType
Pfam:EPL1 5 182 1.5e-9 PFAM
PHD 206 252 1.91e-10 SMART
PHD 315 370 1.31e-8 SMART
low complexity region 622 634 N/A INTRINSIC
low complexity region 817 831 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191921
Predicted Effect probably damaging
Transcript: ENSMUST00000191952
AA Change: V89E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000141499
Gene: ENSMUSG00000025764
AA Change: V89E

DomainStartEndE-ValueType
Pfam:EPL1 30 182 2.3e-23 PFAM
PHD 206 252 1.91e-10 SMART
PHD 315 370 1.31e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000192451
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193080
Predicted Effect probably damaging
Transcript: ENSMUST00000194181
AA Change: V89E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000141670
Gene: ENSMUSG00000025764
AA Change: V89E

DomainStartEndE-ValueType
low complexity region 24 35 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194348
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195200
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195322
Predicted Effect probably damaging
Transcript: ENSMUST00000195846
AA Change: V89E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000141711
Gene: ENSMUSG00000025764
AA Change: V89E

DomainStartEndE-ValueType
Pfam:EPL1 29 152 6e-12 PFAM
Meta Mutation Damage Score 0.7587 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 92.1%
Validation Efficiency 100% (49/49)
MGI Phenotype PHENOTYPE: Though mice homozygous for mutations of this locus show no overt phenotype at birth, fewer survive to weaning than expected by Mendelian ratios. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ap3m2 G A 8: 22,808,467 probably benign Het
Apol11a T A 15: 77,516,931 I206N probably damaging Het
Arfgap3 A G 15: 83,313,563 S331P possibly damaging Het
Arhgef16 A C 4: 154,291,312 L75R probably damaging Het
Cfi T C 3: 129,873,050 V474A probably damaging Het
Dhx8 T C 11: 101,752,319 V739A probably damaging Het
Dpy19l2 T A 9: 24,584,502 H640L probably benign Het
Eif4g3 T A 4: 138,096,870 M57K probably damaging Het
Emilin2 A G 17: 71,255,117 probably null Het
Epc1 T C 18: 6,452,366 E281G possibly damaging Het
Fancd2 G T 6: 113,578,405 S1125I probably damaging Het
Fh1 G A 1: 175,607,819 P366L probably null Het
Gata3 A T 2: 9,863,196 S316T probably damaging Het
Hmcn1 A T 1: 150,657,241 S3064T possibly damaging Het
Inpp5d A T 1: 87,669,685 T193S probably benign Het
Inpp5d A T 1: 87,681,558 I277F probably damaging Het
Itga5 T C 15: 103,351,617 D616G probably damaging Het
Lamb2 T C 9: 108,480,307 S81P probably damaging Het
Lrrc19 G A 4: 94,639,353 P207L probably damaging Het
Maea A G 5: 33,362,696 D147G probably damaging Het
Muc6 T A 7: 141,634,524 E2767V possibly damaging Het
Myom2 A G 8: 15,084,556 Y453C probably damaging Het
Naip2 A T 13: 100,155,021 D1136E probably benign Het
Naip2 G A 13: 100,155,029 probably benign Het
Nap1l1 A G 10: 111,494,820 D362G probably damaging Het
Nap1l4 C T 7: 143,538,216 probably null Het
Nudt21 A C 8: 94,028,833 probably null Het
Nufip1 A G 14: 76,134,870 N475D probably benign Het
Pcdhb8 A G 18: 37,356,703 D478G probably damaging Het
Pla2g4d A G 2: 120,284,167 S28P probably damaging Het
Polr2j C A 5: 136,120,028 N29K probably damaging Het
Ppp2r2a A G 14: 67,038,869 probably benign Het
Ptprk A G 10: 28,551,651 D742G probably damaging Het
Pum2 A G 12: 8,713,524 D227G probably benign Het
Rfxank C A 8: 70,134,303 R221L possibly damaging Het
Shank3 C A 15: 89,503,663 Q317K probably benign Het
Slc22a17 A G 14: 54,907,990 V460A probably damaging Het
Slc39a11 G T 11: 113,559,535 D41E probably damaging Het
Spag17 T C 3: 99,939,363 S68P possibly damaging Het
Sstr5 C T 17: 25,491,298 C319Y possibly damaging Het
Stk17b G T 1: 53,757,590 D339E probably damaging Het
Tagln2 A G 1: 172,505,221 D25G probably benign Het
Ttn C T 2: 76,794,850 V13417I probably benign Het
Vps50 A G 6: 3,545,568 E334G possibly damaging Het
Zfp316 T C 5: 143,264,094 E138G unknown Het
Zfp879 T A 11: 50,833,549 T227S probably benign Het
Other mutations in Jade1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01482:Jade1 APN 3 41613502 missense probably benign 0.01
IGL01564:Jade1 APN 3 41596649 missense possibly damaging 0.91
IGL02428:Jade1 APN 3 41613939 missense probably benign 0.03
IGL03080:Jade1 APN 3 41600075 nonsense probably null
R0763:Jade1 UTSW 3 41613783 missense possibly damaging 0.93
R1539:Jade1 UTSW 3 41604996 missense probably benign 0.00
R1826:Jade1 UTSW 3 41613213 missense probably damaging 1.00
R2143:Jade1 UTSW 3 41604708 missense probably benign
R2255:Jade1 UTSW 3 41591750 missense probably damaging 1.00
R2843:Jade1 UTSW 3 41604845 missense probably damaging 0.98
R2962:Jade1 UTSW 3 41613327 missense probably benign
R3963:Jade1 UTSW 3 41601410 missense probably damaging 0.98
R4753:Jade1 UTSW 3 41596671 nonsense probably null
R4971:Jade1 UTSW 3 41601401 missense probably damaging 1.00
R5278:Jade1 UTSW 3 41589009 missense possibly damaging 0.84
R5327:Jade1 UTSW 3 41613978 missense possibly damaging 0.60
R5384:Jade1 UTSW 3 41591702 missense probably damaging 1.00
R5385:Jade1 UTSW 3 41591702 missense probably damaging 1.00
R5531:Jade1 UTSW 3 41613511 missense probably benign 0.27
R5566:Jade1 UTSW 3 41604903 missense possibly damaging 0.77
R5776:Jade1 UTSW 3 41613792 missense probably benign 0.27
R6299:Jade1 UTSW 3 41613725 missense probably damaging 1.00
R6520:Jade1 UTSW 3 41604482 missense possibly damaging 0.46
R7481:Jade1 UTSW 3 41604690 missense probably benign
R7951:Jade1 UTSW 3 41591755 missense probably damaging 0.99
R8006:Jade1 UTSW 3 41613689 missense probably benign
R8175:Jade1 UTSW 3 41613288 missense probably benign 0.27
X0026:Jade1 UTSW 3 41613413 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AATGAATGCCTGTGCCACTGTCCC -3'
(R):5'- AGACTTCGCCTAGTCGGTCATTCC -3'

Sequencing Primer
(F):5'- GCCACTGTCCCTTTCTCG -3'
(R):5'- TTCTCCAGTAAGAGGGCTCAC -3'
Posted On2014-04-13