Mutagenetix > Incidental Mutation

Incidental Mutation 'R1576:Spag17'

171151

Institutional Source

Beutler Lab

Gene Symbol

Spag17

Ensembl Gene

ENSMUSG00000027867

Gene Name

sperm associated antigen 17

Synonyms

PF6, 4931427F14Rik

MMRRC Submission

039614-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1576 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

99792722-100050638 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 99846679 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 68 (S68P)

Ref Sequence

ENSEMBL: ENSMUSP00000134066 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000164539]

AlphaFold

Q5S003

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000127518

Predicted Effect

possibly damaging
Transcript: ENSMUST00000164539
AA Change: S68P

PolyPhen 2 Score 0.734 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000134066
Gene: ENSMUSG00000027867
AA Change: S68P

Domain	Start	End	E-Value	Type
low complexity region	155	170	N/A	INTRINSIC
low complexity region	384	400	N/A	INTRINSIC
low complexity region	876	887	N/A	INTRINSIC
coiled coil region	909	964	N/A	INTRINSIC
coiled coil region	1079	1120	N/A	INTRINSIC
low complexity region	1179	1190	N/A	INTRINSIC
low complexity region	1192	1205	N/A	INTRINSIC
low complexity region	1209	1220	N/A	INTRINSIC
low complexity region	1223	1238	N/A	INTRINSIC
low complexity region	1394	1405	N/A	INTRINSIC
low complexity region	1931	1942	N/A	INTRINSIC
Pfam:PapD-like	2171	2277	1.2e-15	PFAM

Meta Mutation Damage Score

0.1570

Coding Region Coverage

1x: 99.1%
3x: 98.2%
10x: 96.0%
20x: 92.1%

Validation Efficiency

100% (49/49)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a central pair protein present in the axonemes of cells with a "9 + 2" organization of microtubules. The encoded protein is required for the proper function of the axoneme. Mutations in the orthologous gene in mice lead to primary ciliary dyskinesia characterized by immotile nasal and tracheal cilia, reduced clearance of nasal mucus, profound respiratory distress, hydrocephalus, and neonatal lethality within twelve hours of birth due to impaired airway mucociliary clearance. Single-nucleotide polymorphisms in this gene are associated with human height and targeted mutations lead to skeletal malformations affecting the limbs in mice, suggesting a role for this gene in skeletal development. [provided by RefSeq, Feb 2017]
PHENOTYPE: Homozygous null mice exhibit immotile respiratory cilia with axoneme structural defects, impaired mucociliary clearance, respiratory distress, pulmonary edema, disrupted alveolar epithelium, enlarged brain ventricles consistent with evolving hydrocephalus, failure to suckle, and neonatal lethality. [provided by MGI curators]

Allele List at MGI

All alleles(1) : Targeted, other(1)

Other mutations in this stock

Total: 46 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ap3m2	G	A	8: 23,298,483 (GRCm39)		probably benign	Het
Apol11a	T	A	15: 77,401,131 (GRCm39)	I206N	probably damaging	Het
Arfgap3	A	G	15: 83,197,764 (GRCm39)	S331P	possibly damaging	Het
Arhgef16	A	C	4: 154,375,769 (GRCm39)	L75R	probably damaging	Het
Cfi	T	C	3: 129,666,699 (GRCm39)	V474A	probably damaging	Het
Dhx8	T	C	11: 101,643,145 (GRCm39)	V739A	probably damaging	Het
Dpy19l2	T	A	9: 24,495,798 (GRCm39)	H640L	probably benign	Het
Eif4g3	T	A	4: 137,824,181 (GRCm39)	M57K	probably damaging	Het
Emilin2	A	G	17: 71,562,112 (GRCm39)		probably null	Het
Epc1	T	C	18: 6,452,366 (GRCm39)	E281G	possibly damaging	Het
Fancd2	G	T	6: 113,555,366 (GRCm39)	S1125I	probably damaging	Het
Fh1	G	A	1: 175,435,385 (GRCm39)	P366L	probably null	Het
Gata3	A	T	2: 9,868,007 (GRCm39)	S316T	probably damaging	Het
Hmcn1	A	T	1: 150,532,992 (GRCm39)	S3064T	possibly damaging	Het
Inpp5d	A	T	1: 87,597,407 (GRCm39)	T193S	probably benign	Het
Inpp5d	A	T	1: 87,609,280 (GRCm39)	I277F	probably damaging	Het
Itga5	T	C	15: 103,260,044 (GRCm39)	D616G	probably damaging	Het
Jade1	T	A	3: 41,546,242 (GRCm39)	V89E	probably damaging	Het
Lamb2	T	C	9: 108,357,506 (GRCm39)	S81P	probably damaging	Het
Lrrc19	G	A	4: 94,527,590 (GRCm39)	P207L	probably damaging	Het
Maea	A	G	5: 33,520,040 (GRCm39)	D147G	probably damaging	Het
Muc6	T	A	7: 141,214,437 (GRCm39)	E2767V	possibly damaging	Het
Myom2	A	G	8: 15,134,556 (GRCm39)	Y453C	probably damaging	Het
Naip2	A	T	13: 100,291,529 (GRCm39)	D1136E	probably benign	Het
Naip2	G	A	13: 100,291,537 (GRCm39)		probably benign	Het
Nap1l1	A	G	10: 111,330,681 (GRCm39)	D362G	probably damaging	Het
Nap1l4	C	T	7: 143,091,953 (GRCm39)		probably null	Het
Nudt21	A	C	8: 94,755,461 (GRCm39)		probably null	Het
Nufip1	A	G	14: 76,372,310 (GRCm39)	N475D	probably benign	Het
Pcdhb8	A	G	18: 37,489,756 (GRCm39)	D478G	probably damaging	Het
Pla2g4d	A	G	2: 120,114,648 (GRCm39)	S28P	probably damaging	Het
Polr2j	C	A	5: 136,148,882 (GRCm39)	N29K	probably damaging	Het
Ppp2r2a	A	G	14: 67,276,318 (GRCm39)		probably benign	Het
Ptprk	A	G	10: 28,427,647 (GRCm39)	D742G	probably damaging	Het
Pum2	A	G	12: 8,763,524 (GRCm39)	D227G	probably benign	Het
Rfxank	C	A	8: 70,586,953 (GRCm39)	R221L	possibly damaging	Het
Shank3	C	A	15: 89,387,866 (GRCm39)	Q317K	probably benign	Het
Slc22a17	A	G	14: 55,145,447 (GRCm39)	V460A	probably damaging	Het
Slc39a11	G	T	11: 113,450,361 (GRCm39)	D41E	probably damaging	Het
Sstr5	C	T	17: 25,710,272 (GRCm39)	C319Y	possibly damaging	Het
Stk17b	G	T	1: 53,796,749 (GRCm39)	D339E	probably damaging	Het
Tagln2	A	G	1: 172,332,788 (GRCm39)	D25G	probably benign	Het
Ttn	C	T	2: 76,625,194 (GRCm39)	V13417I	probably benign	Het
Vps50	A	G	6: 3,545,568 (GRCm39)	E334G	possibly damaging	Het
Zfp316	T	C	5: 143,249,849 (GRCm39)	E138G	unknown	Het
Zfp879	T	A	11: 50,724,376 (GRCm39)	T227S	probably benign	Het

Other mutations in Spag17

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01096:Spag17	APN	3	99,970,691 (GRCm39)	missense	probably benign	0.00
IGL01143:Spag17	APN	3	99,846,614 (GRCm39)	missense	probably benign	0.00
IGL01329:Spag17	APN	3	100,002,865 (GRCm39)	missense	probably benign	0.16
IGL01393:Spag17	APN	3	99,934,926 (GRCm39)	missense	possibly damaging	0.53
IGL01617:Spag17	APN	3	100,016,824 (GRCm39)	missense	possibly damaging	0.65
IGL01705:Spag17	APN	3	99,930,046 (GRCm39)	missense	probably benign	0.01
IGL01928:Spag17	APN	3	99,847,390 (GRCm39)	splice site	probably benign
IGL01981:Spag17	APN	3	99,966,149 (GRCm39)	missense	probably benign	0.03
IGL02435:Spag17	APN	3	99,889,760 (GRCm39)	missense	possibly damaging	0.53
IGL02452:Spag17	APN	3	99,934,707 (GRCm39)	missense	probably benign	0.00
IGL02465:Spag17	APN	3	99,983,187 (GRCm39)	missense	probably damaging	0.96
IGL02615:Spag17	APN	3	99,979,401 (GRCm39)	missense	probably benign	0.09
IGL02751:Spag17	APN	3	99,918,110 (GRCm39)	nonsense	probably null
IGL02803:Spag17	APN	3	100,016,713 (GRCm39)	missense	probably benign
IGL02898:Spag17	APN	3	100,008,702 (GRCm39)	missense	probably benign	0.00
IGL03037:Spag17	APN	3	99,979,486 (GRCm39)	splice site	probably null
IGL03068:Spag17	APN	3	99,987,521 (GRCm39)	missense	probably benign	0.35
IGL03131:Spag17	APN	3	99,918,075 (GRCm39)	missense	possibly damaging	0.85
IGL03224:Spag17	APN	3	99,918,156 (GRCm39)	missense	possibly damaging	0.53
FR4342:Spag17	UTSW	3	99,963,568 (GRCm39)	small insertion	probably benign
FR4342:Spag17	UTSW	3	99,963,565 (GRCm39)	small insertion	probably benign
FR4548:Spag17	UTSW	3	99,963,570 (GRCm39)	small insertion	probably benign
FR4589:Spag17	UTSW	3	99,963,574 (GRCm39)	small insertion	probably benign
FR4589:Spag17	UTSW	3	99,963,561 (GRCm39)	small insertion	probably benign
FR4737:Spag17	UTSW	3	99,963,573 (GRCm39)	small insertion	probably benign
FR4976:Spag17	UTSW	3	99,963,571 (GRCm39)	small insertion	probably benign
FR4976:Spag17	UTSW	3	99,963,570 (GRCm39)	small insertion	probably benign
N/A:Spag17	UTSW	3	99,889,570 (GRCm39)	splice site	probably benign
PIT4504001:Spag17	UTSW	3	100,010,426 (GRCm39)	critical splice acceptor site	probably null
PIT4514001:Spag17	UTSW	3	99,920,527 (GRCm39)	missense	possibly damaging	0.53
R0107:Spag17	UTSW	3	99,958,103 (GRCm39)	missense	possibly damaging	0.72
R0230:Spag17	UTSW	3	100,014,143 (GRCm39)	missense	probably benign	0.08
R0243:Spag17	UTSW	3	99,992,684 (GRCm39)	missense	probably benign	0.04
R0321:Spag17	UTSW	3	100,008,719 (GRCm39)	missense	probably damaging	0.99
R0375:Spag17	UTSW	3	99,934,906 (GRCm39)	missense	probably benign
R0417:Spag17	UTSW	3	99,972,870 (GRCm39)	missense	probably benign	0.11
R0490:Spag17	UTSW	3	99,889,727 (GRCm39)	missense	probably damaging	0.97
R0537:Spag17	UTSW	3	100,032,618 (GRCm39)	missense	probably damaging	0.98
R0714:Spag17	UTSW	3	99,987,472 (GRCm39)	missense	probably damaging	0.97
R0844:Spag17	UTSW	3	99,912,101 (GRCm39)	missense	probably benign
R0919:Spag17	UTSW	3	99,979,259 (GRCm39)	splice site	probably benign
R0926:Spag17	UTSW	3	99,979,432 (GRCm39)	missense	probably benign
R1037:Spag17	UTSW	3	100,010,433 (GRCm39)	missense	probably benign	0.01
R1075:Spag17	UTSW	3	100,000,992 (GRCm39)	missense	probably damaging	0.99
R1109:Spag17	UTSW	3	99,934,667 (GRCm39)	missense	possibly damaging	0.86
R1213:Spag17	UTSW	3	100,002,954 (GRCm39)	missense	probably benign	0.01
R1221:Spag17	UTSW	3	99,889,584 (GRCm39)	missense	possibly damaging	0.72
R1586:Spag17	UTSW	3	99,929,068 (GRCm39)	missense	possibly damaging	0.53
R1768:Spag17	UTSW	3	99,934,668 (GRCm39)	missense	possibly damaging	0.53
R1782:Spag17	UTSW	3	99,918,070 (GRCm39)	missense	probably benign	0.02
R1789:Spag17	UTSW	3	99,846,672 (GRCm39)	missense	possibly damaging	0.73
R1945:Spag17	UTSW	3	99,847,298 (GRCm39)	missense	probably benign
R2065:Spag17	UTSW	3	99,920,524 (GRCm39)	missense	probably benign	0.03
R2118:Spag17	UTSW	3	99,956,556 (GRCm39)	missense	possibly damaging	0.72
R2265:Spag17	UTSW	3	99,969,182 (GRCm39)	splice site	probably null
R2266:Spag17	UTSW	3	99,969,182 (GRCm39)	splice site	probably null
R2267:Spag17	UTSW	3	99,969,182 (GRCm39)	splice site	probably null
R2268:Spag17	UTSW	3	99,969,182 (GRCm39)	splice site	probably null
R2271:Spag17	UTSW	3	100,014,113 (GRCm39)	missense	probably damaging	1.00
R2389:Spag17	UTSW	3	100,014,153 (GRCm39)	missense	probably benign	0.27
R2420:Spag17	UTSW	3	99,934,935 (GRCm39)	missense	probably benign
R2422:Spag17	UTSW	3	99,934,935 (GRCm39)	missense	probably benign
R2423:Spag17	UTSW	3	100,010,772 (GRCm39)	missense	probably benign
R3407:Spag17	UTSW	3	99,992,615 (GRCm39)	missense	probably benign	0.09
R3801:Spag17	UTSW	3	99,961,169 (GRCm39)	missense	possibly damaging	0.53
R3856:Spag17	UTSW	3	100,014,075 (GRCm39)	missense	probably damaging	1.00
R4021:Spag17	UTSW	3	99,956,546 (GRCm39)	missense	probably benign	0.00
R4022:Spag17	UTSW	3	99,956,546 (GRCm39)	missense	probably benign	0.00
R4408:Spag17	UTSW	3	100,010,694 (GRCm39)	missense	probably benign
R4468:Spag17	UTSW	3	99,992,682 (GRCm39)	missense	probably damaging	0.98
R4540:Spag17	UTSW	3	99,995,697 (GRCm39)	missense	probably damaging	1.00
R4621:Spag17	UTSW	3	100,010,559 (GRCm39)	missense	probably benign	0.08
R4622:Spag17	UTSW	3	100,010,559 (GRCm39)	missense	probably benign	0.08
R4756:Spag17	UTSW	3	100,010,701 (GRCm39)	missense	possibly damaging	0.68
R4797:Spag17	UTSW	3	99,891,795 (GRCm39)	missense	possibly damaging	0.70
R4855:Spag17	UTSW	3	99,970,649 (GRCm39)	missense	probably benign	0.02
R4887:Spag17	UTSW	3	99,958,147 (GRCm39)	missense	probably damaging	1.00
R4962:Spag17	UTSW	3	99,934,939 (GRCm39)	missense	probably benign
R5030:Spag17	UTSW	3	99,992,657 (GRCm39)	nonsense	probably null
R5042:Spag17	UTSW	3	99,979,465 (GRCm39)	missense	probably damaging	1.00
R5074:Spag17	UTSW	3	99,987,434 (GRCm39)	missense	possibly damaging	0.94
R5195:Spag17	UTSW	3	100,008,704 (GRCm39)	missense	probably benign	0.16
R5200:Spag17	UTSW	3	99,970,787 (GRCm39)	nonsense	probably null
R5267:Spag17	UTSW	3	99,969,264 (GRCm39)	missense	probably damaging	0.98
R5360:Spag17	UTSW	3	100,016,726 (GRCm39)	missense	probably benign	0.00
R5444:Spag17	UTSW	3	99,963,468 (GRCm39)	missense	probably benign	0.06
R5498:Spag17	UTSW	3	100,010,661 (GRCm39)	missense	possibly damaging	0.83
R5503:Spag17	UTSW	3	99,934,560 (GRCm39)	missense	possibly damaging	0.72
R5540:Spag17	UTSW	3	99,963,588 (GRCm39)	missense	possibly damaging	0.91
R5547:Spag17	UTSW	3	99,963,468 (GRCm39)	missense	probably benign	0.06
R5575:Spag17	UTSW	3	99,961,138 (GRCm39)	missense	possibly damaging	0.85
R5629:Spag17	UTSW	3	99,987,435 (GRCm39)	missense	probably benign	0.33
R5639:Spag17	UTSW	3	99,963,482 (GRCm39)	missense	probably damaging	1.00
R5842:Spag17	UTSW	3	99,846,566 (GRCm39)	missense	possibly damaging	0.85
R5976:Spag17	UTSW	3	100,003,107 (GRCm39)	nonsense	probably null
R6082:Spag17	UTSW	3	100,031,501 (GRCm39)	missense	possibly damaging	0.46
R6228:Spag17	UTSW	3	99,929,918 (GRCm39)	missense	probably benign	0.33
R6254:Spag17	UTSW	3	99,972,901 (GRCm39)	missense	probably benign	0.03
R6321:Spag17	UTSW	3	99,995,743 (GRCm39)	missense	probably benign	0.05
R6446:Spag17	UTSW	3	100,010,448 (GRCm39)	missense	probably benign
R6687:Spag17	UTSW	3	100,000,266 (GRCm39)	missense	probably benign	0.07
R6853:Spag17	UTSW	3	99,920,551 (GRCm39)	missense	possibly damaging	0.86
R6946:Spag17	UTSW	3	99,911,999 (GRCm39)	missense	possibly damaging	0.53
R6953:Spag17	UTSW	3	99,942,291 (GRCm39)	missense	possibly damaging	0.53
R7038:Spag17	UTSW	3	99,891,925 (GRCm39)	missense	probably benign	0.00
R7084:Spag17	UTSW	3	99,846,586 (GRCm39)	missense	probably benign	0.18
R7126:Spag17	UTSW	3	100,008,751 (GRCm39)	missense	probably benign	0.00
R7144:Spag17	UTSW	3	99,934,717 (GRCm39)	splice site	probably null
R7198:Spag17	UTSW	3	100,002,888 (GRCm39)	missense	probably benign	0.02
R7318:Spag17	UTSW	3	99,847,299 (GRCm39)	missense	probably benign	0.00
R7403:Spag17	UTSW	3	99,846,691 (GRCm39)	missense	possibly damaging	0.53
R7409:Spag17	UTSW	3	99,934,547 (GRCm39)	missense	possibly damaging	0.73
R7409:Spag17	UTSW	3	99,941,475 (GRCm39)	missense	probably benign	0.00
R7537:Spag17	UTSW	3	99,846,563 (GRCm39)	missense	possibly damaging	0.96
R7609:Spag17	UTSW	3	100,002,911 (GRCm39)	nonsense	probably null
R7772:Spag17	UTSW	3	99,987,434 (GRCm39)	missense	probably damaging	0.98
R7842:Spag17	UTSW	3	99,961,174 (GRCm39)	missense	probably benign	0.18
R7963:Spag17	UTSW	3	99,929,954 (GRCm39)	missense	probably benign	0.02
R8168:Spag17	UTSW	3	99,942,300 (GRCm39)	missense	possibly damaging	0.96
R8291:Spag17	UTSW	3	99,968,166 (GRCm39)	missense	probably benign
R8347:Spag17	UTSW	3	99,934,957 (GRCm39)	missense	probably benign
R8383:Spag17	UTSW	3	99,992,708 (GRCm39)	missense	probably damaging	0.98
R8474:Spag17	UTSW	3	99,934,586 (GRCm39)	missense	probably benign	0.00
R8528:Spag17	UTSW	3	100,031,501 (GRCm39)	missense	possibly damaging	0.46
R8804:Spag17	UTSW	3	99,874,506 (GRCm39)	missense	probably benign
R8809:Spag17	UTSW	3	99,889,738 (GRCm39)	missense	probably benign	0.33
R8818:Spag17	UTSW	3	99,920,543 (GRCm39)	missense	probably benign	0.02
R8830:Spag17	UTSW	3	100,032,751 (GRCm39)	missense	possibly damaging	0.77
R8890:Spag17	UTSW	3	99,911,994 (GRCm39)	missense	possibly damaging	0.73
R9008:Spag17	UTSW	3	99,934,942 (GRCm39)	missense	possibly damaging	0.73
R9095:Spag17	UTSW	3	99,912,092 (GRCm39)	missense	possibly damaging	0.86
R9143:Spag17	UTSW	3	99,934,906 (GRCm39)	missense	probably benign
R9182:Spag17	UTSW	3	99,966,158 (GRCm39)	missense	possibly damaging	0.92
R9211:Spag17	UTSW	3	100,032,614 (GRCm39)	critical splice acceptor site	probably benign
R9344:Spag17	UTSW	3	100,010,793 (GRCm39)	missense	probably benign	0.01
R9354:Spag17	UTSW	3	99,934,905 (GRCm39)	missense	probably benign
R9527:Spag17	UTSW	3	99,970,777 (GRCm39)	missense	probably damaging	1.00
R9658:Spag17	UTSW	3	99,934,932 (GRCm39)	missense	possibly damaging	0.93
R9738:Spag17	UTSW	3	99,934,526 (GRCm39)	missense	possibly damaging	0.53
X0025:Spag17	UTSW	3	100,008,767 (GRCm39)	missense	probably benign	0.31
Z1088:Spag17	UTSW	3	100,002,946 (GRCm39)	missense	probably benign	0.09
Z1176:Spag17	UTSW	3	99,920,309 (GRCm39)	missense	probably benign	0.18
Z1177:Spag17	UTSW	3	99,995,715 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGTGAAGACCACTTAGCCGCTACC -3'
(R):5'- TGGGATGAAGTTCCAATGGACTGC -3'

Sequencing Primer
(F):5'- CTCTGTCTGCTCTTGTAACAGAATG -3'
(R):5'- CAACATTTTACATTGGGTTTGCG -3'

Posted On

2014-04-13