Incidental Mutation 'R1576:Lrrc19'
Institutional Source Beutler Lab
Gene Symbol Lrrc19
Ensembl Gene ENSMUSG00000049799
Gene Nameleucine rich repeat containing 19
MMRRC Submission 039614-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock #R1576 (G1)
Quality Score225
Status Validated
Chromosomal Location94636653-94650144 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 94639353 bp
Amino Acid Change Proline to Leucine at position 207 (P207L)
Ref Sequence ENSEMBL: ENSMUSP00000102718 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030311] [ENSMUST00000053419] [ENSMUST00000107101] [ENSMUST00000107104]
AlphaFold Q8BZT5
Predicted Effect probably benign
Transcript: ENSMUST00000030311
SMART Domains Protein: ENSMUSP00000030311
Gene: ENSMUSG00000028576

low complexity region 22 33 N/A INTRINSIC
low complexity region 47 62 N/A INTRINSIC
coiled coil region 98 271 N/A INTRINSIC
coiled coil region 302 382 N/A INTRINSIC
coiled coil region 430 490 N/A INTRINSIC
coiled coil region 512 546 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000053419
AA Change: P207L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000056094
Gene: ENSMUSG00000049799
AA Change: P207L

LRR 69 93 3.36e2 SMART
LRR 94 117 4.32e0 SMART
LRR 118 141 1.71e1 SMART
LRR 142 166 1.09e2 SMART
LRRCT 174 225 1.24e-6 SMART
Pfam:LRR19-TM 250 364 8.1e-45 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000107101
AA Change: P207L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102718
Gene: ENSMUSG00000049799
AA Change: P207L

LRR 69 93 3.36e2 SMART
LRR 94 117 4.32e0 SMART
LRR 118 141 1.71e1 SMART
LRR 142 166 1.09e2 SMART
LRRCT 174 225 1.24e-6 SMART
Pfam:LRR19-TM 245 364 9.3e-47 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107104
SMART Domains Protein: ENSMUSP00000102721
Gene: ENSMUSG00000028576

low complexity region 22 33 N/A INTRINSIC
low complexity region 47 62 N/A INTRINSIC
coiled coil region 98 271 N/A INTRINSIC
coiled coil region 302 352 N/A INTRINSIC
Meta Mutation Damage Score 0.5920 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 92.1%
Validation Efficiency 100% (49/49)
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ap3m2 G A 8: 22,808,467 probably benign Het
Apol11a T A 15: 77,516,931 I206N probably damaging Het
Arfgap3 A G 15: 83,313,563 S331P possibly damaging Het
Arhgef16 A C 4: 154,291,312 L75R probably damaging Het
Cfi T C 3: 129,873,050 V474A probably damaging Het
Dhx8 T C 11: 101,752,319 V739A probably damaging Het
Dpy19l2 T A 9: 24,584,502 H640L probably benign Het
Eif4g3 T A 4: 138,096,870 M57K probably damaging Het
Emilin2 A G 17: 71,255,117 probably null Het
Epc1 T C 18: 6,452,366 E281G possibly damaging Het
Fancd2 G T 6: 113,578,405 S1125I probably damaging Het
Fh1 G A 1: 175,607,819 P366L probably null Het
Gata3 A T 2: 9,863,196 S316T probably damaging Het
Hmcn1 A T 1: 150,657,241 S3064T possibly damaging Het
Inpp5d A T 1: 87,669,685 T193S probably benign Het
Inpp5d A T 1: 87,681,558 I277F probably damaging Het
Itga5 T C 15: 103,351,617 D616G probably damaging Het
Jade1 T A 3: 41,591,807 V89E probably damaging Het
Lamb2 T C 9: 108,480,307 S81P probably damaging Het
Maea A G 5: 33,362,696 D147G probably damaging Het
Muc6 T A 7: 141,634,524 E2767V possibly damaging Het
Myom2 A G 8: 15,084,556 Y453C probably damaging Het
Naip2 A T 13: 100,155,021 D1136E probably benign Het
Naip2 G A 13: 100,155,029 probably benign Het
Nap1l1 A G 10: 111,494,820 D362G probably damaging Het
Nap1l4 C T 7: 143,538,216 probably null Het
Nudt21 A C 8: 94,028,833 probably null Het
Nufip1 A G 14: 76,134,870 N475D probably benign Het
Pcdhb8 A G 18: 37,356,703 D478G probably damaging Het
Pla2g4d A G 2: 120,284,167 S28P probably damaging Het
Polr2j C A 5: 136,120,028 N29K probably damaging Het
Ppp2r2a A G 14: 67,038,869 probably benign Het
Ptprk A G 10: 28,551,651 D742G probably damaging Het
Pum2 A G 12: 8,713,524 D227G probably benign Het
Rfxank C A 8: 70,134,303 R221L possibly damaging Het
Shank3 C A 15: 89,503,663 Q317K probably benign Het
Slc22a17 A G 14: 54,907,990 V460A probably damaging Het
Slc39a11 G T 11: 113,559,535 D41E probably damaging Het
Spag17 T C 3: 99,939,363 S68P possibly damaging Het
Sstr5 C T 17: 25,491,298 C319Y possibly damaging Het
Stk17b G T 1: 53,757,590 D339E probably damaging Het
Tagln2 A G 1: 172,505,221 D25G probably benign Het
Ttn C T 2: 76,794,850 V13417I probably benign Het
Vps50 A G 6: 3,545,568 E334G possibly damaging Het
Zfp316 T C 5: 143,264,094 E138G unknown Het
Zfp879 T A 11: 50,833,549 T227S probably benign Het
Other mutations in Lrrc19
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01640:Lrrc19 APN 4 94638508 missense probably damaging 0.99
IGL02585:Lrrc19 APN 4 94643325 missense probably benign 0.00
R0087:Lrrc19 UTSW 4 94640772 missense probably damaging 1.00
R0629:Lrrc19 UTSW 4 94638252 missense probably damaging 1.00
R1172:Lrrc19 UTSW 4 94638389 nonsense probably null
R1572:Lrrc19 UTSW 4 94638429 missense probably damaging 1.00
R1589:Lrrc19 UTSW 4 94640950 missense probably benign 0.24
R2107:Lrrc19 UTSW 4 94639294 missense probably benign
R4734:Lrrc19 UTSW 4 94638349 missense probably benign 0.01
R4932:Lrrc19 UTSW 4 94640937 missense probably damaging 1.00
R6079:Lrrc19 UTSW 4 94643343 missense probably benign 0.17
R6969:Lrrc19 UTSW 4 94639373 missense probably benign 0.44
R7293:Lrrc19 UTSW 4 94638390 missense probably benign 0.07
R7596:Lrrc19 UTSW 4 94643355 missense probably benign
R7914:Lrrc19 UTSW 4 94638300 missense probably damaging 0.97
R8333:Lrrc19 UTSW 4 94639350 missense probably benign 0.03
Predicted Primers PCR Primer

Sequencing Primer
(R):5'- tgactgcaagttcagaagagg -3'
Posted On2014-04-13