Incidental Mutation 'R1576:Maea'
ID171157
Institutional Source Beutler Lab
Gene Symbol Maea
Ensembl Gene ENSMUSG00000079562
Gene Namemacrophage erythroblast attacher
Synonyms
MMRRC Submission 039614-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1576 (G1)
Quality Score177
Status Validated
Chromosome5
Chromosomal Location33335509-33373296 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 33362696 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 147 (D147G)
Ref Sequence ENSEMBL: ENSMUSP00000144584 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114449] [ENSMUST00000200716] [ENSMUST00000200882] [ENSMUST00000202113]
Predicted Effect probably benign
Transcript: ENSMUST00000114449
AA Change: D153G

PolyPhen 2 Score 0.176 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000110093
Gene: ENSMUSG00000079562
AA Change: D153G

DomainStartEndE-ValueType
low complexity region 64 75 N/A INTRINSIC
LisH 121 153 3.01e-6 SMART
CTLH 159 216 2.16e-16 SMART
CRA 212 306 8.31e-14 SMART
low complexity region 347 358 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000200716
AA Change: D147G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000144584
Gene: ENSMUSG00000079562
AA Change: D147G

DomainStartEndE-ValueType
low complexity region 64 75 N/A INTRINSIC
LisH 115 146 1.1e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000200882
Predicted Effect probably benign
Transcript: ENSMUST00000202113
SMART Domains Protein: ENSMUSP00000144238
Gene: ENSMUSG00000079562

DomainStartEndE-ValueType
low complexity region 16 27 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202941
Meta Mutation Damage Score 0.5581 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 92.1%
Validation Efficiency 100% (49/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that mediates the attachment of erythroblasts to macrophages. This attachment promotes terminal maturation and enucleation of erythroblasts, presumably by suppressing apoptosis. The encoded protein is an integral membrane protein with the N-terminus on the extracellular side and the C-terminus on the cytoplasmic side of the cell. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for a gene trapped allele die perinatally displaying reduced fetal size, pallor, reduced numbers of erythroblastic islands, defects in terminal erythroid maturation, and severely impaired terminal differentiation of fetal liver macrophages. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ap3m2 G A 8: 22,808,467 probably benign Het
Apol11a T A 15: 77,516,931 I206N probably damaging Het
Arfgap3 A G 15: 83,313,563 S331P possibly damaging Het
Arhgef16 A C 4: 154,291,312 L75R probably damaging Het
Cfi T C 3: 129,873,050 V474A probably damaging Het
Dhx8 T C 11: 101,752,319 V739A probably damaging Het
Dpy19l2 T A 9: 24,584,502 H640L probably benign Het
Eif4g3 T A 4: 138,096,870 M57K probably damaging Het
Emilin2 A G 17: 71,255,117 probably null Het
Epc1 T C 18: 6,452,366 E281G possibly damaging Het
Fancd2 G T 6: 113,578,405 S1125I probably damaging Het
Fh1 G A 1: 175,607,819 P366L probably null Het
Gata3 A T 2: 9,863,196 S316T probably damaging Het
Hmcn1 A T 1: 150,657,241 S3064T possibly damaging Het
Inpp5d A T 1: 87,669,685 T193S probably benign Het
Inpp5d A T 1: 87,681,558 I277F probably damaging Het
Itga5 T C 15: 103,351,617 D616G probably damaging Het
Jade1 T A 3: 41,591,807 V89E probably damaging Het
Lamb2 T C 9: 108,480,307 S81P probably damaging Het
Lrrc19 G A 4: 94,639,353 P207L probably damaging Het
Muc6 T A 7: 141,634,524 E2767V possibly damaging Het
Myom2 A G 8: 15,084,556 Y453C probably damaging Het
Naip2 A T 13: 100,155,021 D1136E probably benign Het
Naip2 G A 13: 100,155,029 probably benign Het
Nap1l1 A G 10: 111,494,820 D362G probably damaging Het
Nap1l4 C T 7: 143,538,216 probably null Het
Nudt21 A C 8: 94,028,833 probably null Het
Nufip1 A G 14: 76,134,870 N475D probably benign Het
Pcdhb8 A G 18: 37,356,703 D478G probably damaging Het
Pla2g4d A G 2: 120,284,167 S28P probably damaging Het
Polr2j C A 5: 136,120,028 N29K probably damaging Het
Ppp2r2a A G 14: 67,038,869 probably benign Het
Ptprk A G 10: 28,551,651 D742G probably damaging Het
Pum2 A G 12: 8,713,524 D227G probably benign Het
Rfxank C A 8: 70,134,303 R221L possibly damaging Het
Shank3 C A 15: 89,503,663 Q317K probably benign Het
Slc22a17 A G 14: 54,907,990 V460A probably damaging Het
Slc39a11 G T 11: 113,559,535 D41E probably damaging Het
Spag17 T C 3: 99,939,363 S68P possibly damaging Het
Sstr5 C T 17: 25,491,298 C319Y possibly damaging Het
Stk17b G T 1: 53,757,590 D339E probably damaging Het
Tagln2 A G 1: 172,505,221 D25G probably benign Het
Ttn C T 2: 76,794,850 V13417I probably benign Het
Vps50 A G 6: 3,545,568 E334G possibly damaging Het
Zfp316 T C 5: 143,264,094 E138G unknown Het
Zfp879 T A 11: 50,833,549 T227S probably benign Het
Other mutations in Maea
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00925:Maea APN 5 33372301 missense probably benign 0.01
IGL01540:Maea APN 5 33358566 missense probably benign 0.12
R0365:Maea UTSW 5 33360443 missense probably benign 0.01
R0562:Maea UTSW 5 33372301 missense probably benign 0.01
R1450:Maea UTSW 5 33365800 critical splice donor site probably null
R2177:Maea UTSW 5 33371690 missense probably benign 0.00
R2520:Maea UTSW 5 33358510 missense probably damaging 0.98
R4580:Maea UTSW 5 33360488 missense possibly damaging 0.92
R4710:Maea UTSW 5 33368690 missense probably benign 0.01
R5786:Maea UTSW 5 33368683 missense probably benign 0.01
R6127:Maea UTSW 5 33335518 unclassified probably benign
R7178:Maea UTSW 5 33358510 missense probably damaging 0.98
R7542:Maea UTSW 5 33371663 missense probably damaging 1.00
R7828:Maea UTSW 5 33360378 missense probably benign 0.01
R7909:Maea UTSW 5 33370474 missense possibly damaging 0.71
R7909:Maea UTSW 5 33370476 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CAGTAGGCATCTGCCATATGTCAGC -3'
(R):5'- TCCTCCAATAGAGACCCGTCCATTC -3'

Sequencing Primer
(F):5'- GCCATATGTCAGCTTCCCAG -3'
(R):5'- CGTCCATTCCCACCAGG -3'
Posted On2014-04-13