Incidental Mutation 'R1576:Zfp316'
ID171160
Institutional Source Beutler Lab
Gene Symbol Zfp316
Ensembl Gene ENSMUSG00000046658
Gene Namezinc finger protein 316
SynonymsEmzf1
MMRRC Submission 039614-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.181) question?
Stock #R1576 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location143249697-143270022 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 143264094 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 138 (E138G)
Ref Sequence ENSEMBL: ENSMUSP00000125416 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051665] [ENSMUST00000161448]
Predicted Effect unknown
Transcript: ENSMUST00000051665
AA Change: E138G
SMART Domains Protein: ENSMUSP00000059418
Gene: ENSMUSG00000046658
AA Change: E138G

DomainStartEndE-ValueType
low complexity region 30 68 N/A INTRINSIC
low complexity region 74 88 N/A INTRINSIC
low complexity region 134 147 N/A INTRINSIC
KRAB 155 215 4.31e-37 SMART
low complexity region 239 262 N/A INTRINSIC
ZnF_C2H2 341 363 1.58e-3 SMART
ZnF_C2H2 369 391 1.45e-2 SMART
ZnF_C2H2 397 419 6.88e-4 SMART
ZnF_C2H2 425 447 3.63e-3 SMART
ZnF_C2H2 453 475 1.2e-3 SMART
ZnF_C2H2 481 501 2.17e1 SMART
low complexity region 524 558 N/A INTRINSIC
low complexity region 568 584 N/A INTRINSIC
low complexity region 649 664 N/A INTRINSIC
low complexity region 691 707 N/A INTRINSIC
ZnF_C2H2 708 730 1.2e-3 SMART
ZnF_C2H2 736 758 3.58e-2 SMART
ZnF_C2H2 764 786 1.45e-2 SMART
ZnF_C2H2 792 814 1.99e0 SMART
ZnF_C2H2 820 842 2.82e0 SMART
ZnF_C2H2 848 870 7.9e-4 SMART
ZnF_C2H2 876 898 1.45e-2 SMART
ZnF_C2H2 904 926 9.88e-5 SMART
ZnF_C2H2 932 954 2.09e-3 SMART
low complexity region 964 990 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000161448
AA Change: E138G
SMART Domains Protein: ENSMUSP00000125416
Gene: ENSMUSG00000046658
AA Change: E138G

DomainStartEndE-ValueType
low complexity region 30 68 N/A INTRINSIC
low complexity region 74 88 N/A INTRINSIC
low complexity region 134 147 N/A INTRINSIC
KRAB 155 215 4.31e-37 SMART
low complexity region 239 262 N/A INTRINSIC
ZnF_C2H2 341 363 1.58e-3 SMART
ZnF_C2H2 369 391 1.45e-2 SMART
ZnF_C2H2 397 419 6.88e-4 SMART
ZnF_C2H2 425 447 3.63e-3 SMART
ZnF_C2H2 453 475 1.2e-3 SMART
ZnF_C2H2 481 501 2.17e1 SMART
low complexity region 524 558 N/A INTRINSIC
low complexity region 568 584 N/A INTRINSIC
low complexity region 649 664 N/A INTRINSIC
low complexity region 691 707 N/A INTRINSIC
ZnF_C2H2 708 730 1.2e-3 SMART
ZnF_C2H2 736 758 3.58e-2 SMART
ZnF_C2H2 764 786 1.45e-2 SMART
ZnF_C2H2 792 814 1.99e0 SMART
ZnF_C2H2 820 842 2.82e0 SMART
ZnF_C2H2 848 870 7.9e-4 SMART
ZnF_C2H2 876 898 1.45e-2 SMART
ZnF_C2H2 904 926 9.88e-5 SMART
ZnF_C2H2 932 954 2.09e-3 SMART
low complexity region 964 990 N/A INTRINSIC
Meta Mutation Damage Score 0.0605 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 92.1%
Validation Efficiency 100% (49/49)
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ap3m2 G A 8: 22,808,467 probably benign Het
Apol11a T A 15: 77,516,931 I206N probably damaging Het
Arfgap3 A G 15: 83,313,563 S331P possibly damaging Het
Arhgef16 A C 4: 154,291,312 L75R probably damaging Het
Cfi T C 3: 129,873,050 V474A probably damaging Het
Dhx8 T C 11: 101,752,319 V739A probably damaging Het
Dpy19l2 T A 9: 24,584,502 H640L probably benign Het
Eif4g3 T A 4: 138,096,870 M57K probably damaging Het
Emilin2 A G 17: 71,255,117 probably null Het
Epc1 T C 18: 6,452,366 E281G possibly damaging Het
Fancd2 G T 6: 113,578,405 S1125I probably damaging Het
Fh1 G A 1: 175,607,819 P366L probably null Het
Gata3 A T 2: 9,863,196 S316T probably damaging Het
Hmcn1 A T 1: 150,657,241 S3064T possibly damaging Het
Inpp5d A T 1: 87,669,685 T193S probably benign Het
Inpp5d A T 1: 87,681,558 I277F probably damaging Het
Itga5 T C 15: 103,351,617 D616G probably damaging Het
Jade1 T A 3: 41,591,807 V89E probably damaging Het
Lamb2 T C 9: 108,480,307 S81P probably damaging Het
Lrrc19 G A 4: 94,639,353 P207L probably damaging Het
Maea A G 5: 33,362,696 D147G probably damaging Het
Muc6 T A 7: 141,634,524 E2767V possibly damaging Het
Myom2 A G 8: 15,084,556 Y453C probably damaging Het
Naip2 A T 13: 100,155,021 D1136E probably benign Het
Naip2 G A 13: 100,155,029 probably benign Het
Nap1l1 A G 10: 111,494,820 D362G probably damaging Het
Nap1l4 C T 7: 143,538,216 probably null Het
Nudt21 A C 8: 94,028,833 probably null Het
Nufip1 A G 14: 76,134,870 N475D probably benign Het
Pcdhb8 A G 18: 37,356,703 D478G probably damaging Het
Pla2g4d A G 2: 120,284,167 S28P probably damaging Het
Polr2j C A 5: 136,120,028 N29K probably damaging Het
Ppp2r2a A G 14: 67,038,869 probably benign Het
Ptprk A G 10: 28,551,651 D742G probably damaging Het
Pum2 A G 12: 8,713,524 D227G probably benign Het
Rfxank C A 8: 70,134,303 R221L possibly damaging Het
Shank3 C A 15: 89,503,663 Q317K probably benign Het
Slc22a17 A G 14: 54,907,990 V460A probably damaging Het
Slc39a11 G T 11: 113,559,535 D41E probably damaging Het
Spag17 T C 3: 99,939,363 S68P possibly damaging Het
Sstr5 C T 17: 25,491,298 C319Y possibly damaging Het
Stk17b G T 1: 53,757,590 D339E probably damaging Het
Tagln2 A G 1: 172,505,221 D25G probably benign Het
Ttn C T 2: 76,794,850 V13417I probably benign Het
Vps50 A G 6: 3,545,568 E334G possibly damaging Het
Zfp879 T A 11: 50,833,549 T227S probably benign Het
Other mutations in Zfp316
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01304:Zfp316 APN 5 143254426 missense probably benign 0.00
IGL01783:Zfp316 APN 5 143262876 missense unknown
R0415:Zfp316 UTSW 5 143264491 missense unknown
R0423:Zfp316 UTSW 5 143253238 missense probably damaging 0.98
R1579:Zfp316 UTSW 5 143253562 missense probably damaging 0.97
R1836:Zfp316 UTSW 5 143253423 missense probably damaging 1.00
R2058:Zfp316 UTSW 5 143263406 missense unknown
R4004:Zfp316 UTSW 5 143255119 missense possibly damaging 0.86
R4198:Zfp316 UTSW 5 143254471 missense probably benign 0.05
R4436:Zfp316 UTSW 5 143254048 missense probably damaging 1.00
R4961:Zfp316 UTSW 5 143253414 missense probably damaging 0.98
R5579:Zfp316 UTSW 5 143264491 missense unknown
R5642:Zfp316 UTSW 5 143264091 missense unknown
R5701:Zfp316 UTSW 5 143254377 missense probably benign 0.08
R5795:Zfp316 UTSW 5 143262839 missense unknown
R5861:Zfp316 UTSW 5 143263340 missense unknown
R5965:Zfp316 UTSW 5 143264672 splice site probably null
R6414:Zfp316 UTSW 5 143254884 missense possibly damaging 0.71
R6547:Zfp316 UTSW 5 143254197 missense probably damaging 1.00
R6922:Zfp316 UTSW 5 143253525 missense probably damaging 0.98
R7002:Zfp316 UTSW 5 143263355 missense unknown
R7361:Zfp316 UTSW 5 143254675 missense probably benign 0.01
R7414:Zfp316 UTSW 5 143264652 missense unknown
R7693:Zfp316 UTSW 5 143263412 missense unknown
X0022:Zfp316 UTSW 5 143255056 missense probably damaging 0.99
Z1177:Zfp316 UTSW 5 143253558 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TGTCCTCACTGATGAAGCACCACC -3'
(R):5'- TGGAAGCCAACTCAGCAGACAATG -3'

Sequencing Primer
(F):5'- ACCACCCATAGAGGGCTCG -3'
(R):5'- ggaggtgatgatgatgatgatgg -3'
Posted On2014-04-13