Mutagenetix > Incidental Mutation

Incidental Mutation 'R1576:Fancd2'

171162

Institutional Source

Beutler Lab

Gene Symbol

Fancd2

Ensembl Gene

ENSMUSG00000034023

Gene Name

Fanconi anemia, complementation group D2

Synonyms

2410150O07Rik

MMRRC Submission

039614-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R1576 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

113531682-113597017 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 113578405 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Isoleucine at position 1125 (S1125I)

Ref Sequence

ENSEMBL: ENSMUSP00000144928 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000036340] [ENSMUST00000129462] [ENSMUST00000204827]

AlphaFold

Q80V62

Predicted Effect

probably damaging
Transcript: ENSMUST00000036340
AA Change: S1125I

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000045667
Gene: ENSMUSG00000034023
AA Change: S1125I

Domain	Start	End	E-Value	Type
Pfam:FancD2	1	1415	N/A	PFAM
low complexity region	1430	1450	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000129462

SMART Domains

Protein: ENSMUSP00000145220
Gene: ENSMUSG00000034023

Domain	Start	End	E-Value	Type
Pfam:FancD2	1	80	4.9e-26	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000204827
AA Change: S1125I

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000144928
Gene: ENSMUSG00000034023
AA Change: S1125I

Domain	Start	End	E-Value	Type
Pfam:FancD2	1	1402	N/A	PFAM
low complexity region	1417	1437	N/A	INTRINSIC

Meta Mutation Damage Score

0.1703

Coding Region Coverage

1x: 99.1%
3x: 98.2%
10x: 96.0%
20x: 92.1%

Validation Efficiency

100% (49/49)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Fanconi anemia complementation group (FANC) currently includes FANCA, FANCB, FANCC, FANCD1 (also called BRCA2), FANCD2, FANCE, FANCF, FANCG, FANCI, FANCJ (also called BRIP1), FANCL, FANCM and FANCN (also called PALB2). The previously defined group FANCH is the same as FANCA. Fanconi anemia is a genetically heterogeneous recessive disorder characterized by cytogenetic instability, hypersensitivity to DNA crosslinking agents, increased chromosomal breakage, and defective DNA repair. The members of the Fanconi anemia complementation group do not share sequence similarity; they are related by their assembly into a common nuclear protein complex. This gene encodes the protein for complementation group D2. This protein is monoubiquinated in response to DNA damage, resulting in its localization to nuclear foci with other proteins (BRCA1 AND BRCA2) involved in homology-directed DNA repair. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2016]
PHENOTYPE: Homozygous mutant mice exhibit defects observed in human patients with Fanconi anemia (FA) meiotic defects and germ cell loss. In addition, mutant mice display perinatal lethality, susceptiblity ot epithelial cancer, and microphthalmia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 46 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ap3m2	G	A	8: 22,808,467		probably benign	Het
Apol11a	T	A	15: 77,516,931	I206N	probably damaging	Het
Arfgap3	A	G	15: 83,313,563	S331P	possibly damaging	Het
Arhgef16	A	C	4: 154,291,312	L75R	probably damaging	Het
Cfi	T	C	3: 129,873,050	V474A	probably damaging	Het
Dhx8	T	C	11: 101,752,319	V739A	probably damaging	Het
Dpy19l2	T	A	9: 24,584,502	H640L	probably benign	Het
Eif4g3	T	A	4: 138,096,870	M57K	probably damaging	Het
Emilin2	A	G	17: 71,255,117		probably null	Het
Epc1	T	C	18: 6,452,366	E281G	possibly damaging	Het
Fh1	G	A	1: 175,607,819	P366L	probably null	Het
Gata3	A	T	2: 9,863,196	S316T	probably damaging	Het
Hmcn1	A	T	1: 150,657,241	S3064T	possibly damaging	Het
Inpp5d	A	T	1: 87,669,685	T193S	probably benign	Het
Inpp5d	A	T	1: 87,681,558	I277F	probably damaging	Het
Itga5	T	C	15: 103,351,617	D616G	probably damaging	Het
Jade1	T	A	3: 41,591,807	V89E	probably damaging	Het
Lamb2	T	C	9: 108,480,307	S81P	probably damaging	Het
Lrrc19	G	A	4: 94,639,353	P207L	probably damaging	Het
Maea	A	G	5: 33,362,696	D147G	probably damaging	Het
Muc6	T	A	7: 141,634,524	E2767V	possibly damaging	Het
Myom2	A	G	8: 15,084,556	Y453C	probably damaging	Het
Naip2	A	T	13: 100,155,021	D1136E	probably benign	Het
Naip2	G	A	13: 100,155,029		probably benign	Het
Nap1l1	A	G	10: 111,494,820	D362G	probably damaging	Het
Nap1l4	C	T	7: 143,538,216		probably null	Het
Nudt21	A	C	8: 94,028,833		probably null	Het
Nufip1	A	G	14: 76,134,870	N475D	probably benign	Het
Pcdhb8	A	G	18: 37,356,703	D478G	probably damaging	Het
Pla2g4d	A	G	2: 120,284,167	S28P	probably damaging	Het
Polr2j	C	A	5: 136,120,028	N29K	probably damaging	Het
Ppp2r2a	A	G	14: 67,038,869		probably benign	Het
Ptprk	A	G	10: 28,551,651	D742G	probably damaging	Het
Pum2	A	G	12: 8,713,524	D227G	probably benign	Het
Rfxank	C	A	8: 70,134,303	R221L	possibly damaging	Het
Shank3	C	A	15: 89,503,663	Q317K	probably benign	Het
Slc22a17	A	G	14: 54,907,990	V460A	probably damaging	Het
Slc39a11	G	T	11: 113,559,535	D41E	probably damaging	Het
Spag17	T	C	3: 99,939,363	S68P	possibly damaging	Het
Sstr5	C	T	17: 25,491,298	C319Y	possibly damaging	Het
Stk17b	G	T	1: 53,757,590	D339E	probably damaging	Het
Tagln2	A	G	1: 172,505,221	D25G	probably benign	Het
Ttn	C	T	2: 76,794,850	V13417I	probably benign	Het
Vps50	A	G	6: 3,545,568	E334G	possibly damaging	Het
Zfp316	T	C	5: 143,264,094	E138G	unknown	Het
Zfp879	T	A	11: 50,833,549	T227S	probably benign	Het

Other mutations in Fancd2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00401:Fancd2	APN	6	113564396	critical splice donor site	probably null
IGL00475:Fancd2	APN	6	113568610	missense	probably benign	0.01
IGL01319:Fancd2	APN	6	113584899	missense	probably damaging	0.98
IGL01339:Fancd2	APN	6	113553752	missense	probably benign	0.00
IGL01373:Fancd2	APN	6	113553752	missense	probably benign	0.00
IGL01393:Fancd2	APN	6	113577360	splice site	probably benign
IGL01630:Fancd2	APN	6	113563124	missense	probably damaging	1.00
IGL01769:Fancd2	APN	6	113545111	missense	possibly damaging	0.90
IGL01882:Fancd2	APN	6	113546640	missense	probably benign	0.05
IGL02029:Fancd2	APN	6	113570975	missense	probably benign	0.44
IGL02224:Fancd2	APN	6	113568320	critical splice donor site	probably null
IGL02271:Fancd2	APN	6	113535759	splice site	probably benign
IGL02352:Fancd2	APN	6	113563112	missense	probably damaging	1.00
IGL02359:Fancd2	APN	6	113563112	missense	probably damaging	1.00
IGL02427:Fancd2	APN	6	113549352	splice site	probably null
IGL02512:Fancd2	APN	6	113570943	missense	probably damaging	1.00
IGL02530:Fancd2	APN	6	113562461	missense	probably damaging	1.00
IGL02801:Fancd2	APN	6	113593317	missense	probably benign	0.00
IGL03090:Fancd2	APN	6	113537597	splice site	probably null
IGL03247:Fancd2	APN	6	113568208	missense	probably benign	0.03
R0278:Fancd2	UTSW	6	113548448	critical splice donor site	probably null
R0401:Fancd2	UTSW	6	113548343	missense	possibly damaging	0.46
R0420:Fancd2	UTSW	6	113536979	missense	probably damaging	0.98
R0496:Fancd2	UTSW	6	113555130	splice site	probably benign
R0762:Fancd2	UTSW	6	113574658	missense	probably benign	0.20
R0827:Fancd2	UTSW	6	113586249	critical splice donor site	probably null
R1225:Fancd2	UTSW	6	113535861	missense	probably damaging	0.99
R2010:Fancd2	UTSW	6	113593291	missense	probably damaging	0.96
R2079:Fancd2	UTSW	6	113555187	missense	probably damaging	1.00
R2118:Fancd2	UTSW	6	113560074	splice site	probably benign
R2141:Fancd2	UTSW	6	113549321	missense	probably benign	0.00
R2168:Fancd2	UTSW	6	113591159	missense	possibly damaging	0.92
R2180:Fancd2	UTSW	6	113574637	missense	probably benign	0.33
R3016:Fancd2	UTSW	6	113536726	missense	probably benign	0.00
R3153:Fancd2	UTSW	6	113593269	missense	possibly damaging	0.55
R3154:Fancd2	UTSW	6	113593269	missense	possibly damaging	0.55
R3783:Fancd2	UTSW	6	113565204	missense	probably damaging	1.00
R3786:Fancd2	UTSW	6	113565204	missense	probably damaging	1.00
R3787:Fancd2	UTSW	6	113565204	missense	probably damaging	1.00
R4379:Fancd2	UTSW	6	113561716	missense	probably benign	0.00
R4388:Fancd2	UTSW	6	113556368	missense	probably damaging	0.99
R4544:Fancd2	UTSW	6	113572642	critical splice acceptor site	probably null
R4598:Fancd2	UTSW	6	113585477	missense	probably benign	0.06
R4832:Fancd2	UTSW	6	113553722	missense	probably benign	0.16
R4841:Fancd2	UTSW	6	113562430	missense	probably damaging	1.00
R4922:Fancd2	UTSW	6	113585473	missense	probably benign	0.03
R5375:Fancd2	UTSW	6	113568712	missense	possibly damaging	0.93
R5579:Fancd2	UTSW	6	113560051	critical splice acceptor site	probably null
R5782:Fancd2	UTSW	6	113548872	missense	probably benign	0.00
R5871:Fancd2	UTSW	6	113556282	missense	probably benign	0.30
R5901:Fancd2	UTSW	6	113549365	missense	probably damaging	1.00
R5909:Fancd2	UTSW	6	113561711	missense	probably benign
R6026:Fancd2	UTSW	6	113551770	missense	possibly damaging	0.46
R6166:Fancd2	UTSW	6	113555251	missense	possibly damaging	0.67
R6393:Fancd2	UTSW	6	113578413	missense	probably benign	0.01
R6666:Fancd2	UTSW	6	113585509	missense	probably damaging	0.96
R6669:Fancd2	UTSW	6	113593327	missense	probably benign	0.00
R6676:Fancd2	UTSW	6	113537665	nonsense	probably null
R6762:Fancd2	UTSW	6	113586016	splice site	probably null
R6911:Fancd2	UTSW	6	113548385	missense	probably damaging	0.98
R6992:Fancd2	UTSW	6	113571018	critical splice donor site	probably null
R7091:Fancd2	UTSW	6	113545101	missense	probably damaging	1.00
R7252:Fancd2	UTSW	6	113556285	missense	probably damaging	0.98
R7343:Fancd2	UTSW	6	113536939	missense	probably benign	0.01
R7344:Fancd2	UTSW	6	113568709	missense	probably benign	0.09
R7354:Fancd2	UTSW	6	113595946	missense	unknown
R7489:Fancd2	UTSW	6	113564304	missense	probably benign
R7501:Fancd2	UTSW	6	113548403	missense	possibly damaging	0.95
R7504:Fancd2	UTSW	6	113545038	missense	probably damaging	1.00
R7992:Fancd2	UTSW	6	113565204	missense	probably damaging	1.00
R8027:Fancd2	UTSW	6	113546622	missense	probably damaging	1.00
R8487:Fancd2	UTSW	6	113568226	missense	probably damaging	1.00
R8509:Fancd2	UTSW	6	113572570	missense	probably benign	0.00
R8757:Fancd2	UTSW	6	113560093	missense	possibly damaging	0.91
R8960:Fancd2	UTSW	6	113563168	critical splice donor site	probably null
R8978:Fancd2	UTSW	6	113585546	splice site	probably benign
R9110:Fancd2	UTSW	6	113535801	missense	possibly damaging	0.94
R9116:Fancd2	UTSW	6	113555219	missense	probably benign	0.00
R9490:Fancd2	UTSW	6	113578455	missense	probably damaging	0.98
R9667:Fancd2	UTSW	6	113553756	nonsense	probably null
Z1088:Fancd2	UTSW	6	113581422	missense	probably benign	0.00
Z1177:Fancd2	UTSW	6	113545025	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- CTGTTATGAGTCCAGACACGAGCC -3'
(R):5'- GTAAACATGGTCTCCTTGGTGGAGC -3'

Sequencing Primer
(F):5'- cctatcccatcctgtcacatc -3'
(R):5'- TCTCCTTGGTGGAGCAAGAAG -3'

Posted On

2014-04-13