Incidental Mutation 'R1576:Nap1l4'
ID171164
Institutional Source Beutler Lab
Gene Symbol Nap1l4
Ensembl Gene ENSMUSG00000059119
Gene Namenucleosome assembly protein 1-like 4
SynonymsNap2, D7Wsu30e, 2810410H14Rik
MMRRC Submission 039614-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.123) question?
Stock #R1576 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location143513579-143549106 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) C to T at 143538216 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000146474 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072727] [ENSMUST00000207870] [ENSMUST00000207948] [ENSMUST00000208093] [ENSMUST00000208190] [ENSMUST00000209098]
Predicted Effect probably null
Transcript: ENSMUST00000072727
SMART Domains Protein: ENSMUSP00000072510
Gene: ENSMUSG00000059119

DomainStartEndE-ValueType
Pfam:NAP 65 338 5e-103 PFAM
low complexity region 341 370 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000207870
Predicted Effect probably benign
Transcript: ENSMUST00000207948
Predicted Effect probably null
Transcript: ENSMUST00000208093
Predicted Effect probably null
Transcript: ENSMUST00000208190
Predicted Effect probably benign
Transcript: ENSMUST00000208317
Predicted Effect probably null
Transcript: ENSMUST00000209098
Meta Mutation Damage Score 0.9595 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 92.1%
Validation Efficiency 100% (49/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the nucleosome assembly protein (NAP) family which can interact with both core and linker histones. It can shuttle between the cytoplasm and nucleus, suggesting a role as a histone chaperone. This gene is one of several located near the imprinted gene domain of 11p15.5, an important tumor-suppressor gene region. Alterations in this region have been associated with the Beckwith-Wiedemann syndrome, Wilms tumor, rhabdomyosarcoma, adrenocortical carcinoma, and lung, ovarian, and breast cancer. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ap3m2 G A 8: 22,808,467 probably benign Het
Apol11a T A 15: 77,516,931 I206N probably damaging Het
Arfgap3 A G 15: 83,313,563 S331P possibly damaging Het
Arhgef16 A C 4: 154,291,312 L75R probably damaging Het
Cfi T C 3: 129,873,050 V474A probably damaging Het
Dhx8 T C 11: 101,752,319 V739A probably damaging Het
Dpy19l2 T A 9: 24,584,502 H640L probably benign Het
Eif4g3 T A 4: 138,096,870 M57K probably damaging Het
Emilin2 A G 17: 71,255,117 probably null Het
Epc1 T C 18: 6,452,366 E281G possibly damaging Het
Fancd2 G T 6: 113,578,405 S1125I probably damaging Het
Fh1 G A 1: 175,607,819 P366L probably null Het
Gata3 A T 2: 9,863,196 S316T probably damaging Het
Hmcn1 A T 1: 150,657,241 S3064T possibly damaging Het
Inpp5d A T 1: 87,669,685 T193S probably benign Het
Inpp5d A T 1: 87,681,558 I277F probably damaging Het
Itga5 T C 15: 103,351,617 D616G probably damaging Het
Jade1 T A 3: 41,591,807 V89E probably damaging Het
Lamb2 T C 9: 108,480,307 S81P probably damaging Het
Lrrc19 G A 4: 94,639,353 P207L probably damaging Het
Maea A G 5: 33,362,696 D147G probably damaging Het
Muc6 T A 7: 141,634,524 E2767V possibly damaging Het
Myom2 A G 8: 15,084,556 Y453C probably damaging Het
Naip2 A T 13: 100,155,021 D1136E probably benign Het
Naip2 G A 13: 100,155,029 probably benign Het
Nap1l1 A G 10: 111,494,820 D362G probably damaging Het
Nudt21 A C 8: 94,028,833 probably null Het
Nufip1 A G 14: 76,134,870 N475D probably benign Het
Pcdhb8 A G 18: 37,356,703 D478G probably damaging Het
Pla2g4d A G 2: 120,284,167 S28P probably damaging Het
Polr2j C A 5: 136,120,028 N29K probably damaging Het
Ppp2r2a A G 14: 67,038,869 probably benign Het
Ptprk A G 10: 28,551,651 D742G probably damaging Het
Pum2 A G 12: 8,713,524 D227G probably benign Het
Rfxank C A 8: 70,134,303 R221L possibly damaging Het
Shank3 C A 15: 89,503,663 Q317K probably benign Het
Slc22a17 A G 14: 54,907,990 V460A probably damaging Het
Slc39a11 G T 11: 113,559,535 D41E probably damaging Het
Spag17 T C 3: 99,939,363 S68P possibly damaging Het
Sstr5 C T 17: 25,491,298 C319Y possibly damaging Het
Stk17b G T 1: 53,757,590 D339E probably damaging Het
Tagln2 A G 1: 172,505,221 D25G probably benign Het
Ttn C T 2: 76,794,850 V13417I probably benign Het
Vps50 A G 6: 3,545,568 E334G possibly damaging Het
Zfp316 T C 5: 143,264,094 E138G unknown Het
Zfp879 T A 11: 50,833,549 T227S probably benign Het
Other mutations in Nap1l4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01483:Nap1l4 APN 7 143527316 splice site probably null
IGL02696:Nap1l4 APN 7 143524161 missense possibly damaging 0.67
IGL02710:Nap1l4 APN 7 143524261 missense probably benign 0.00
IGL03059:Nap1l4 APN 7 143527165 critical splice donor site probably null
IGL03164:Nap1l4 APN 7 143538216 critical splice donor site probably null
IGL03240:Nap1l4 APN 7 143538245 missense probably benign 0.00
Ballerina UTSW 7 143534463 splice site probably null
R1705:Nap1l4 UTSW 7 143541760 start codon destroyed probably null 1.00
R1967:Nap1l4 UTSW 7 143534287 missense probably damaging 0.99
R1989:Nap1l4 UTSW 7 143527184 missense probably damaging 0.99
R3734:Nap1l4 UTSW 7 143534395 splice site probably null
R4799:Nap1l4 UTSW 7 143534463 splice site probably null
R5367:Nap1l4 UTSW 7 143534298 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TTACCCAACTGGACATGGAGCCTG -3'
(R):5'- AGGTCTGGCATGGCATTTCCTTAC -3'

Sequencing Primer
(F):5'- TACAAGTGTCCCACAGTTGG -3'
(R):5'- GGCATGGCATTTCCTTACTTAGC -3'
Posted On2014-04-13