Incidental Mutation 'R1576:Ap3m2'
ID171167
Institutional Source Beutler Lab
Gene Symbol Ap3m2
Ensembl Gene ENSMUSG00000031539
Gene Nameadaptor-related protein complex 3, mu 2 subunit
SynonymsAP-3B, 5830445E16Rik
MMRRC Submission 039614-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1576 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location22787354-22805622 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) G to A at 22808467 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000147967 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000163739] [ENSMUST00000210656]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000068068
Predicted Effect probably benign
Transcript: ENSMUST00000163739
SMART Domains Protein: ENSMUSP00000128446
Gene: ENSMUSG00000031539

DomainStartEndE-ValueType
Pfam:Clat_adaptor_s 1 137 2.7e-8 PFAM
Pfam:Adap_comp_sub 165 418 1.3e-76 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186344
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210148
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210476
Predicted Effect probably benign
Transcript: ENSMUST00000210656
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 92.1%
Validation Efficiency 100% (49/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the heterotetrameric adaptor-related protein comlex 3 (AP-3), which belongs to the adaptor complexes medium subunits family. The AP-3 complex plays a role in protein trafficking to lysosomes and specialized organelles. Multiple alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, Aug 2008]
PHENOTYPE: Homozygous null mice suffer from spontaneous recurrent epileptic seizures, are more susceptible to drug-induced seizures and show impaired GABA release, fewer synaptic vesicles, enhanced long-term potentiation, and abnormal propagation of neuronal excitability via the temporoammonic pathway. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apol11a T A 15: 77,516,931 I206N probably damaging Het
Arfgap3 A G 15: 83,313,563 S331P possibly damaging Het
Arhgef16 A C 4: 154,291,312 L75R probably damaging Het
Cfi T C 3: 129,873,050 V474A probably damaging Het
Dhx8 T C 11: 101,752,319 V739A probably damaging Het
Dpy19l2 T A 9: 24,584,502 H640L probably benign Het
Eif4g3 T A 4: 138,096,870 M57K probably damaging Het
Emilin2 A G 17: 71,255,117 probably null Het
Epc1 T C 18: 6,452,366 E281G possibly damaging Het
Fancd2 G T 6: 113,578,405 S1125I probably damaging Het
Fh1 G A 1: 175,607,819 P366L probably null Het
Gata3 A T 2: 9,863,196 S316T probably damaging Het
Hmcn1 A T 1: 150,657,241 S3064T possibly damaging Het
Inpp5d A T 1: 87,669,685 T193S probably benign Het
Inpp5d A T 1: 87,681,558 I277F probably damaging Het
Itga5 T C 15: 103,351,617 D616G probably damaging Het
Jade1 T A 3: 41,591,807 V89E probably damaging Het
Lamb2 T C 9: 108,480,307 S81P probably damaging Het
Lrrc19 G A 4: 94,639,353 P207L probably damaging Het
Maea A G 5: 33,362,696 D147G probably damaging Het
Muc6 T A 7: 141,634,524 E2767V possibly damaging Het
Myom2 A G 8: 15,084,556 Y453C probably damaging Het
Naip2 A T 13: 100,155,021 D1136E probably benign Het
Naip2 G A 13: 100,155,029 probably benign Het
Nap1l1 A G 10: 111,494,820 D362G probably damaging Het
Nap1l4 C T 7: 143,538,216 probably null Het
Nudt21 A C 8: 94,028,833 probably null Het
Nufip1 A G 14: 76,134,870 N475D probably benign Het
Pcdhb8 A G 18: 37,356,703 D478G probably damaging Het
Pla2g4d A G 2: 120,284,167 S28P probably damaging Het
Polr2j C A 5: 136,120,028 N29K probably damaging Het
Ppp2r2a A G 14: 67,038,869 probably benign Het
Ptprk A G 10: 28,551,651 D742G probably damaging Het
Pum2 A G 12: 8,713,524 D227G probably benign Het
Rfxank C A 8: 70,134,303 R221L possibly damaging Het
Shank3 C A 15: 89,503,663 Q317K probably benign Het
Slc22a17 A G 14: 54,907,990 V460A probably damaging Het
Slc39a11 G T 11: 113,559,535 D41E probably damaging Het
Spag17 T C 3: 99,939,363 S68P possibly damaging Het
Sstr5 C T 17: 25,491,298 C319Y possibly damaging Het
Stk17b G T 1: 53,757,590 D339E probably damaging Het
Tagln2 A G 1: 172,505,221 D25G probably benign Het
Ttn C T 2: 76,794,850 V13417I probably benign Het
Vps50 A G 6: 3,545,568 E334G possibly damaging Het
Zfp316 T C 5: 143,264,094 E138G unknown Het
Zfp879 T A 11: 50,833,549 T227S probably benign Het
Other mutations in Ap3m2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00510:Ap3m2 APN 8 22797227 splice site probably null
IGL01288:Ap3m2 APN 8 22803915 missense probably benign
IGL01391:Ap3m2 APN 8 22799647 missense probably benign 0.00
R0599:Ap3m2 UTSW 8 22793112 missense possibly damaging 0.88
R1566:Ap3m2 UTSW 8 22803951 missense probably damaging 1.00
R2917:Ap3m2 UTSW 8 22799799 missense probably benign 0.00
R4884:Ap3m2 UTSW 8 22803981 missense probably damaging 1.00
R4995:Ap3m2 UTSW 8 22803776 missense probably benign 0.19
R5100:Ap3m2 UTSW 8 22789388 missense probably benign
R5738:Ap3m2 UTSW 8 22803861 missense possibly damaging 0.52
R7030:Ap3m2 UTSW 8 22799791 missense probably damaging 0.99
R7378:Ap3m2 UTSW 8 22804010 missense probably benign 0.31
R7602:Ap3m2 UTSW 8 22792754 missense probably benign 0.00
R7732:Ap3m2 UTSW 8 22797089 missense probably benign 0.00
R7866:Ap3m2 UTSW 8 22799658 missense probably benign 0.02
R7949:Ap3m2 UTSW 8 22799658 missense probably benign 0.02
Z1177:Ap3m2 UTSW 8 22791321 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- AGCATCTGAAGCCGCTGAATGGAC -3'
(R):5'- AGCTGCCTAAGCAACCACTTCCTG -3'

Sequencing Primer
(F):5'- GCCGCTGAATGGACTCTTTG -3'
(R):5'- TAAGCAACCACTTCCTGAAATG -3'
Posted On2014-04-13