Incidental Mutation 'R1576:Nudt21'
ID171169
Institutional Source Beutler Lab
Gene Symbol Nudt21
Ensembl Gene ENSMUSG00000031754
Gene Namenudix (nucleoside diphosphate linked moiety X)-type motif 21
Synonyms25kDa, Cpsf5, 5730530J16Rik, 3110048P04Rik
MMRRC Submission 039614-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1576 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location94015496-94037031 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to C at 94028833 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000148597 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034204] [ENSMUST00000034204] [ENSMUST00000212622] [ENSMUST00000212622] [ENSMUST00000212911] [ENSMUST00000212911] [ENSMUST00000212981] [ENSMUST00000212981]
Predicted Effect probably null
Transcript: ENSMUST00000034204
SMART Domains Protein: ENSMUSP00000034204
Gene: ENSMUSG00000031754

DomainStartEndE-ValueType
Pfam:NUDIX_2 35 222 9.9e-85 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000034204
SMART Domains Protein: ENSMUSP00000034204
Gene: ENSMUSG00000031754

DomainStartEndE-ValueType
Pfam:NUDIX_2 35 222 9.9e-85 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000212622
Predicted Effect probably null
Transcript: ENSMUST00000212622
Predicted Effect probably null
Transcript: ENSMUST00000212911
Predicted Effect probably null
Transcript: ENSMUST00000212911
Predicted Effect probably null
Transcript: ENSMUST00000212981
Predicted Effect probably null
Transcript: ENSMUST00000212981
Meta Mutation Damage Score 0.9586 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 92.1%
Validation Efficiency 100% (49/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is one subunit of a cleavage factor required for 3' RNA cleavage and polyadenylation processing. The interaction of the protein with the RNA is one of the earliest steps in the assembly of the 3' end processing complex and facilitates the recruitment of other processing factors. This gene encodes the 25kD subunit of the protein complex, which is composed of four polypeptides. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ap3m2 G A 8: 22,808,467 probably benign Het
Apol11a T A 15: 77,516,931 I206N probably damaging Het
Arfgap3 A G 15: 83,313,563 S331P possibly damaging Het
Arhgef16 A C 4: 154,291,312 L75R probably damaging Het
Cfi T C 3: 129,873,050 V474A probably damaging Het
Dhx8 T C 11: 101,752,319 V739A probably damaging Het
Dpy19l2 T A 9: 24,584,502 H640L probably benign Het
Eif4g3 T A 4: 138,096,870 M57K probably damaging Het
Emilin2 A G 17: 71,255,117 probably null Het
Epc1 T C 18: 6,452,366 E281G possibly damaging Het
Fancd2 G T 6: 113,578,405 S1125I probably damaging Het
Fh1 G A 1: 175,607,819 P366L probably null Het
Gata3 A T 2: 9,863,196 S316T probably damaging Het
Hmcn1 A T 1: 150,657,241 S3064T possibly damaging Het
Inpp5d A T 1: 87,681,558 I277F probably damaging Het
Inpp5d A T 1: 87,669,685 T193S probably benign Het
Itga5 T C 15: 103,351,617 D616G probably damaging Het
Jade1 T A 3: 41,591,807 V89E probably damaging Het
Lamb2 T C 9: 108,480,307 S81P probably damaging Het
Lrrc19 G A 4: 94,639,353 P207L probably damaging Het
Maea A G 5: 33,362,696 D147G probably damaging Het
Muc6 T A 7: 141,634,524 E2767V possibly damaging Het
Myom2 A G 8: 15,084,556 Y453C probably damaging Het
Naip2 A T 13: 100,155,021 D1136E probably benign Het
Naip2 G A 13: 100,155,029 probably benign Het
Nap1l1 A G 10: 111,494,820 D362G probably damaging Het
Nap1l4 C T 7: 143,538,216 probably null Het
Nufip1 A G 14: 76,134,870 N475D probably benign Het
Pcdhb8 A G 18: 37,356,703 D478G probably damaging Het
Pla2g4d A G 2: 120,284,167 S28P probably damaging Het
Polr2j C A 5: 136,120,028 N29K probably damaging Het
Ppp2r2a A G 14: 67,038,869 probably benign Het
Ptprk A G 10: 28,551,651 D742G probably damaging Het
Pum2 A G 12: 8,713,524 D227G probably benign Het
Rfxank C A 8: 70,134,303 R221L possibly damaging Het
Shank3 C A 15: 89,503,663 Q317K probably benign Het
Slc22a17 A G 14: 54,907,990 V460A probably damaging Het
Slc39a11 G T 11: 113,559,535 D41E probably damaging Het
Spag17 T C 3: 99,939,363 S68P possibly damaging Het
Sstr5 C T 17: 25,491,298 C319Y possibly damaging Het
Stk17b G T 1: 53,757,590 D339E probably damaging Het
Tagln2 A G 1: 172,505,221 D25G probably benign Het
Ttn C T 2: 76,794,850 V13417I probably benign Het
Vps50 A G 6: 3,545,568 E334G possibly damaging Het
Zfp316 T C 5: 143,264,094 E138G unknown Het
Zfp879 T A 11: 50,833,549 T227S probably benign Het
Other mutations in Nudt21
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02226:Nudt21 APN 8 94019701 nonsense probably null
PIT4544001:Nudt21 UTSW 8 94019597 missense unknown
R1172:Nudt21 UTSW 8 94031129 splice site probably benign
R6293:Nudt21 UTSW 8 94028878 missense probably damaging 1.00
R6474:Nudt21 UTSW 8 94019654 missense probably benign 0.02
R6961:Nudt21 UTSW 8 94028880 missense probably benign
R7312:Nudt21 UTSW 8 94019599 missense probably benign 0.00
R7737:Nudt21 UTSW 8 94022833 missense probably damaging 1.00
R7755:Nudt21 UTSW 8 94022865 missense probably benign 0.33
Predicted Primers PCR Primer
(F):5'- CGACTCCCCAGGCATCAGACATA -3'
(R):5'- GCAAAACAACTGAACCCAGAAGGGAATT -3'

Sequencing Primer
(F):5'- acatacattcaggcaaaacacac -3'
(R):5'- ATTCTCAGGTGTGTGTATTCATTAC -3'
Posted On2014-04-13