Incidental Mutation 'R1576:Nap1l1'
ID171174
Institutional Source Beutler Lab
Gene Symbol Nap1l1
Ensembl Gene ENSMUSG00000058799
Gene Namenucleosome assembly protein 1-like 1
SynonymsD10Ertd68e
MMRRC Submission 039614-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.393) question?
Stock #R1576 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location111473223-111498150 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 111494820 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 362 (D362G)
Ref Sequence ENSEMBL: ENSMUSP00000151972 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065917] [ENSMUST00000171797] [ENSMUST00000217908] [ENSMUST00000218828] [ENSMUST00000219143] [ENSMUST00000219961]
Predicted Effect probably damaging
Transcript: ENSMUST00000065917
AA Change: D362G

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000070068
Gene: ENSMUSG00000058799
AA Change: D362G

DomainStartEndE-ValueType
coiled coil region 6 31 N/A INTRINSIC
Pfam:NAP 75 346 1.5e-96 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000171797
AA Change: D389G

PolyPhen 2 Score 0.862 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000126850
Gene: ENSMUSG00000058799
AA Change: D389G

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
coiled coil region 33 58 N/A INTRINSIC
Pfam:NAP 103 372 9.6e-110 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000217908
AA Change: D362G

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000218828
AA Change: D362G

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218982
Predicted Effect unknown
Transcript: ENSMUST00000219143
AA Change: D362G
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219718
Predicted Effect possibly damaging
Transcript: ENSMUST00000219961
AA Change: D362G

PolyPhen 2 Score 0.904 (Sensitivity: 0.82; Specificity: 0.94)
Meta Mutation Damage Score 0.0870 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 92.1%
Validation Efficiency 100% (49/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the nucleosome assembly protein (NAP) family. This protein participates in DNA replication and may play a role in modulating chromatin formation and contribute to the regulation of cell proliferation. Alternative splicing results in multiple transcript variants encoding different isoforms; however, not all have been fully described. [provided by RefSeq, Apr 2015]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ap3m2 G A 8: 22,808,467 probably benign Het
Apol11a T A 15: 77,516,931 I206N probably damaging Het
Arfgap3 A G 15: 83,313,563 S331P possibly damaging Het
Arhgef16 A C 4: 154,291,312 L75R probably damaging Het
Cfi T C 3: 129,873,050 V474A probably damaging Het
Dhx8 T C 11: 101,752,319 V739A probably damaging Het
Dpy19l2 T A 9: 24,584,502 H640L probably benign Het
Eif4g3 T A 4: 138,096,870 M57K probably damaging Het
Emilin2 A G 17: 71,255,117 probably null Het
Epc1 T C 18: 6,452,366 E281G possibly damaging Het
Fancd2 G T 6: 113,578,405 S1125I probably damaging Het
Fh1 G A 1: 175,607,819 P366L probably null Het
Gata3 A T 2: 9,863,196 S316T probably damaging Het
Hmcn1 A T 1: 150,657,241 S3064T possibly damaging Het
Inpp5d A T 1: 87,669,685 T193S probably benign Het
Inpp5d A T 1: 87,681,558 I277F probably damaging Het
Itga5 T C 15: 103,351,617 D616G probably damaging Het
Jade1 T A 3: 41,591,807 V89E probably damaging Het
Lamb2 T C 9: 108,480,307 S81P probably damaging Het
Lrrc19 G A 4: 94,639,353 P207L probably damaging Het
Maea A G 5: 33,362,696 D147G probably damaging Het
Muc6 T A 7: 141,634,524 E2767V possibly damaging Het
Myom2 A G 8: 15,084,556 Y453C probably damaging Het
Naip2 A T 13: 100,155,021 D1136E probably benign Het
Naip2 G A 13: 100,155,029 probably benign Het
Nap1l4 C T 7: 143,538,216 probably null Het
Nudt21 A C 8: 94,028,833 probably null Het
Nufip1 A G 14: 76,134,870 N475D probably benign Het
Pcdhb8 A G 18: 37,356,703 D478G probably damaging Het
Pla2g4d A G 2: 120,284,167 S28P probably damaging Het
Polr2j C A 5: 136,120,028 N29K probably damaging Het
Ppp2r2a A G 14: 67,038,869 probably benign Het
Ptprk A G 10: 28,551,651 D742G probably damaging Het
Pum2 A G 12: 8,713,524 D227G probably benign Het
Rfxank C A 8: 70,134,303 R221L possibly damaging Het
Shank3 C A 15: 89,503,663 Q317K probably benign Het
Slc22a17 A G 14: 54,907,990 V460A probably damaging Het
Slc39a11 G T 11: 113,559,535 D41E probably damaging Het
Spag17 T C 3: 99,939,363 S68P possibly damaging Het
Sstr5 C T 17: 25,491,298 C319Y possibly damaging Het
Stk17b G T 1: 53,757,590 D339E probably damaging Het
Tagln2 A G 1: 172,505,221 D25G probably benign Het
Ttn C T 2: 76,794,850 V13417I probably benign Het
Vps50 A G 6: 3,545,568 E334G possibly damaging Het
Zfp316 T C 5: 143,264,094 E138G unknown Het
Zfp879 T A 11: 50,833,549 T227S probably benign Het
Other mutations in Nap1l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01154:Nap1l1 APN 10 111486675 missense probably damaging 0.98
IGL01453:Nap1l1 APN 10 111492978 missense probably benign 0.09
IGL01734:Nap1l1 APN 10 111492899 missense probably benign 0.26
IGL01843:Nap1l1 APN 10 111492911 missense possibly damaging 0.93
PIT1430001:Nap1l1 UTSW 10 111486736 missense probably damaging 1.00
PIT4131001:Nap1l1 UTSW 10 111486722 missense probably null
R0020:Nap1l1 UTSW 10 111491023 missense probably benign 0.01
R0020:Nap1l1 UTSW 10 111491023 missense probably benign 0.01
R0131:Nap1l1 UTSW 10 111485509 missense probably benign 0.17
R0131:Nap1l1 UTSW 10 111485509 missense probably benign 0.17
R0132:Nap1l1 UTSW 10 111485509 missense probably benign 0.17
R0601:Nap1l1 UTSW 10 111490363 splice site probably benign
R1619:Nap1l1 UTSW 10 111493379 missense possibly damaging 0.77
R1969:Nap1l1 UTSW 10 111491053 missense probably benign 0.03
R2071:Nap1l1 UTSW 10 111492900 missense possibly damaging 0.46
R2383:Nap1l1 UTSW 10 111493411 missense probably damaging 1.00
R3836:Nap1l1 UTSW 10 111495322 splice site probably null
R3837:Nap1l1 UTSW 10 111495322 splice site probably null
R3838:Nap1l1 UTSW 10 111495322 splice site probably null
R3839:Nap1l1 UTSW 10 111495322 splice site probably null
R4084:Nap1l1 UTSW 10 111490077 missense possibly damaging 0.92
R4609:Nap1l1 UTSW 10 111492880 nonsense probably null
R4985:Nap1l1 UTSW 10 111490083 missense probably benign 0.01
R5906:Nap1l1 UTSW 10 111491030 nonsense probably null
R5982:Nap1l1 UTSW 10 111495368 missense possibly damaging 0.71
R6522:Nap1l1 UTSW 10 111494223 missense probably damaging 0.99
R6868:Nap1l1 UTSW 10 111494808 missense probably damaging 1.00
R7134:Nap1l1 UTSW 10 111494794 critical splice acceptor site probably null
R7202:Nap1l1 UTSW 10 111491103 missense probably damaging 1.00
R7789:Nap1l1 UTSW 10 111490456 missense probably benign 0.01
R7950:Nap1l1 UTSW 10 111492908 missense probably damaging 1.00
R8404:Nap1l1 UTSW 10 111481301 start codon destroyed probably null 0.53
R8502:Nap1l1 UTSW 10 111481301 start codon destroyed probably null 0.53
Predicted Primers PCR Primer
(F):5'- TGAGAGCACTGAGAGCATTTCTGC -3'
(R):5'- CTGCTCACCTTTGGGTCATAGTCTG -3'

Sequencing Primer
(F):5'- AGAGCATTTCTGCTCAGGTC -3'
(R):5'- aaaaaaaaaatGTTGCTGAGTTTTGC -3'
Posted On2014-04-13