Incidental Mutation 'R1576:Pum2'
ID 171178
Institutional Source Beutler Lab
Gene Symbol Pum2
Ensembl Gene ENSMUSG00000020594
Gene Name pumilio RNA-binding family member 2
Synonyms Pumm2, 5730503J23Rik
MMRRC Submission 039614-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1576 (G1)
Quality Score 225
Status Validated
Chromosome 12
Chromosomal Location 8724134-8802581 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 8763524 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 227 (D227G)
Ref Sequence ENSEMBL: ENSMUSP00000126876 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020915] [ENSMUST00000111122] [ENSMUST00000111123] [ENSMUST00000163569] [ENSMUST00000163730] [ENSMUST00000165293] [ENSMUST00000169089] [ENSMUST00000169750] [ENSMUST00000168361] [ENSMUST00000178015] [ENSMUST00000166965] [ENSMUST00000170037]
AlphaFold Q80U58
Predicted Effect probably benign
Transcript: ENSMUST00000020915
AA Change: D227G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000020915
Gene: ENSMUSG00000020594
AA Change: D227G

DomainStartEndE-ValueType
low complexity region 193 206 N/A INTRINSIC
low complexity region 269 290 N/A INTRINSIC
low complexity region 319 336 N/A INTRINSIC
low complexity region 353 378 N/A INTRINSIC
low complexity region 464 490 N/A INTRINSIC
low complexity region 498 509 N/A INTRINSIC
low complexity region 521 535 N/A INTRINSIC
low complexity region 542 576 N/A INTRINSIC
low complexity region 591 609 N/A INTRINSIC
Pumilio 642 677 2.35e-7 SMART
Pumilio 678 713 6.54e-6 SMART
Pumilio 714 749 2.89e-7 SMART
Pumilio 750 785 3.37e-8 SMART
Pumilio 786 821 4.84e-9 SMART
Pumilio 822 857 3.2e-9 SMART
Pumilio 858 893 5.78e-7 SMART
Pumilio 901 936 3.62e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111122
AA Change: D227G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000106751
Gene: ENSMUSG00000020594
AA Change: D227G

DomainStartEndE-ValueType
low complexity region 193 206 N/A INTRINSIC
low complexity region 269 290 N/A INTRINSIC
low complexity region 324 341 N/A INTRINSIC
low complexity region 358 383 N/A INTRINSIC
low complexity region 469 495 N/A INTRINSIC
low complexity region 503 514 N/A INTRINSIC
low complexity region 526 540 N/A INTRINSIC
low complexity region 547 602 N/A INTRINSIC
low complexity region 630 660 N/A INTRINSIC
low complexity region 675 693 N/A INTRINSIC
Pumilio 726 761 2.35e-7 SMART
Pumilio 762 797 6.54e-6 SMART
Pumilio 798 833 2.89e-7 SMART
Pumilio 834 869 3.37e-8 SMART
Pumilio 870 905 4.84e-9 SMART
Pumilio 906 941 3.2e-9 SMART
Pumilio 942 977 5.78e-7 SMART
Pumilio 985 1020 3.62e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111123
AA Change: D227G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000106752
Gene: ENSMUSG00000020594
AA Change: D227G

DomainStartEndE-ValueType
low complexity region 193 206 N/A INTRINSIC
low complexity region 269 290 N/A INTRINSIC
low complexity region 324 341 N/A INTRINSIC
low complexity region 358 383 N/A INTRINSIC
low complexity region 469 495 N/A INTRINSIC
low complexity region 503 514 N/A INTRINSIC
low complexity region 526 540 N/A INTRINSIC
low complexity region 547 602 N/A INTRINSIC
low complexity region 630 660 N/A INTRINSIC
low complexity region 675 693 N/A INTRINSIC
Pumilio 726 761 2.35e-7 SMART
Pumilio 762 797 6.54e-6 SMART
Pumilio 798 833 2.89e-7 SMART
Pumilio 834 869 3.37e-8 SMART
Pumilio 870 905 4.84e-9 SMART
Pumilio 906 941 3.2e-9 SMART
Pumilio 942 977 5.78e-7 SMART
Pumilio 985 1020 3.62e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000163569
AA Change: D227G

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000131074
Gene: ENSMUSG00000020594
AA Change: D227G

DomainStartEndE-ValueType
low complexity region 193 206 N/A INTRINSIC
low complexity region 269 290 N/A INTRINSIC
low complexity region 324 341 N/A INTRINSIC
low complexity region 358 383 N/A INTRINSIC
low complexity region 469 495 N/A INTRINSIC
low complexity region 503 514 N/A INTRINSIC
low complexity region 526 540 N/A INTRINSIC
low complexity region 547 602 N/A INTRINSIC
low complexity region 630 660 N/A INTRINSIC
low complexity region 675 693 N/A INTRINSIC
Pumilio 726 761 2.35e-7 SMART
Pumilio 762 797 6.54e-6 SMART
Pumilio 798 832 1.29e-4 SMART
Pumilio 836 871 3.37e-8 SMART
Pumilio 872 907 4.84e-9 SMART
Pumilio 908 943 3.2e-9 SMART
Pumilio 944 979 5.78e-7 SMART
Pumilio 987 1022 3.62e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000163730
Predicted Effect probably benign
Transcript: ENSMUST00000165293
Predicted Effect probably benign
Transcript: ENSMUST00000169089
AA Change: D227G

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000132122
Gene: ENSMUSG00000020594
AA Change: D227G

DomainStartEndE-ValueType
low complexity region 193 206 N/A INTRINSIC
low complexity region 269 290 N/A INTRINSIC
low complexity region 324 341 N/A INTRINSIC
low complexity region 358 383 N/A INTRINSIC
low complexity region 469 495 N/A INTRINSIC
low complexity region 503 514 N/A INTRINSIC
low complexity region 526 540 N/A INTRINSIC
low complexity region 547 581 N/A INTRINSIC
low complexity region 596 614 N/A INTRINSIC
Pumilio 647 682 2.35e-7 SMART
Pumilio 683 718 6.54e-6 SMART
Pumilio 719 754 2.89e-7 SMART
Pumilio 755 790 3.37e-8 SMART
Pumilio 791 826 4.84e-9 SMART
Pumilio 827 862 3.2e-9 SMART
Pumilio 863 898 5.78e-7 SMART
Pumilio 906 941 3.62e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000169750
AA Change: D227G

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000126876
Gene: ENSMUSG00000020594
AA Change: D227G

DomainStartEndE-ValueType
low complexity region 193 206 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000168361
AA Change: D227G

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000128292
Gene: ENSMUSG00000020594
AA Change: D227G

DomainStartEndE-ValueType
low complexity region 193 206 N/A INTRINSIC
low complexity region 269 290 N/A INTRINSIC
low complexity region 324 341 N/A INTRINSIC
low complexity region 358 383 N/A INTRINSIC
low complexity region 469 495 N/A INTRINSIC
low complexity region 503 514 N/A INTRINSIC
low complexity region 526 540 N/A INTRINSIC
low complexity region 547 602 N/A INTRINSIC
low complexity region 630 660 N/A INTRINSIC
low complexity region 675 693 N/A INTRINSIC
Pumilio 726 761 2.35e-7 SMART
Pumilio 762 797 6.54e-6 SMART
Pumilio 798 832 1.29e-4 SMART
Pumilio 836 871 3.37e-8 SMART
Pumilio 872 907 4.84e-9 SMART
Pumilio 908 943 3.2e-9 SMART
Pumilio 944 979 5.78e-7 SMART
Pumilio 987 1022 3.62e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000178015
AA Change: D227G

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000137020
Gene: ENSMUSG00000020594
AA Change: D227G

DomainStartEndE-ValueType
low complexity region 193 206 N/A INTRINSIC
low complexity region 269 290 N/A INTRINSIC
low complexity region 324 341 N/A INTRINSIC
low complexity region 358 383 N/A INTRINSIC
low complexity region 469 495 N/A INTRINSIC
low complexity region 503 514 N/A INTRINSIC
low complexity region 526 540 N/A INTRINSIC
low complexity region 547 581 N/A INTRINSIC
low complexity region 596 614 N/A INTRINSIC
Pumilio 647 682 2.35e-7 SMART
Pumilio 683 718 6.54e-6 SMART
Pumilio 719 754 2.89e-7 SMART
Pumilio 755 790 3.37e-8 SMART
Pumilio 791 826 4.84e-9 SMART
Pumilio 827 862 3.2e-9 SMART
Pumilio 863 898 5.78e-7 SMART
Pumilio 906 941 3.62e-8 SMART
Predicted Effect unknown
Transcript: ENSMUST00000171418
AA Change: D88G
SMART Domains Protein: ENSMUSP00000126616
Gene: ENSMUSG00000020594
AA Change: D88G

DomainStartEndE-ValueType
low complexity region 55 68 N/A INTRINSIC
low complexity region 131 152 N/A INTRINSIC
low complexity region 180 197 N/A INTRINSIC
low complexity region 214 234 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000166965
Predicted Effect probably benign
Transcript: ENSMUST00000170037
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 92.1%
Validation Efficiency 100% (49/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to a family of RNA-binding proteins. The encoded protein functions as a translational repressor during embryonic development and cell differentiation. This protein is also thought to be a positive regulator of cell proliferation in adipose-derived stem cells. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Sep 2013]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit significantly smaller testes and seminiferous tubule degeneration but are otherwise viable and fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ap3m2 G A 8: 23,298,483 (GRCm39) probably benign Het
Apol11a T A 15: 77,401,131 (GRCm39) I206N probably damaging Het
Arfgap3 A G 15: 83,197,764 (GRCm39) S331P possibly damaging Het
Arhgef16 A C 4: 154,375,769 (GRCm39) L75R probably damaging Het
Cfi T C 3: 129,666,699 (GRCm39) V474A probably damaging Het
Dhx8 T C 11: 101,643,145 (GRCm39) V739A probably damaging Het
Dpy19l2 T A 9: 24,495,798 (GRCm39) H640L probably benign Het
Eif4g3 T A 4: 137,824,181 (GRCm39) M57K probably damaging Het
Emilin2 A G 17: 71,562,112 (GRCm39) probably null Het
Epc1 T C 18: 6,452,366 (GRCm39) E281G possibly damaging Het
Fancd2 G T 6: 113,555,366 (GRCm39) S1125I probably damaging Het
Fh1 G A 1: 175,435,385 (GRCm39) P366L probably null Het
Gata3 A T 2: 9,868,007 (GRCm39) S316T probably damaging Het
Hmcn1 A T 1: 150,532,992 (GRCm39) S3064T possibly damaging Het
Inpp5d A T 1: 87,597,407 (GRCm39) T193S probably benign Het
Inpp5d A T 1: 87,609,280 (GRCm39) I277F probably damaging Het
Itga5 T C 15: 103,260,044 (GRCm39) D616G probably damaging Het
Jade1 T A 3: 41,546,242 (GRCm39) V89E probably damaging Het
Lamb2 T C 9: 108,357,506 (GRCm39) S81P probably damaging Het
Lrrc19 G A 4: 94,527,590 (GRCm39) P207L probably damaging Het
Maea A G 5: 33,520,040 (GRCm39) D147G probably damaging Het
Muc6 T A 7: 141,214,437 (GRCm39) E2767V possibly damaging Het
Myom2 A G 8: 15,134,556 (GRCm39) Y453C probably damaging Het
Naip2 A T 13: 100,291,529 (GRCm39) D1136E probably benign Het
Naip2 G A 13: 100,291,537 (GRCm39) probably benign Het
Nap1l1 A G 10: 111,330,681 (GRCm39) D362G probably damaging Het
Nap1l4 C T 7: 143,091,953 (GRCm39) probably null Het
Nudt21 A C 8: 94,755,461 (GRCm39) probably null Het
Nufip1 A G 14: 76,372,310 (GRCm39) N475D probably benign Het
Pcdhb8 A G 18: 37,489,756 (GRCm39) D478G probably damaging Het
Pla2g4d A G 2: 120,114,648 (GRCm39) S28P probably damaging Het
Polr2j C A 5: 136,148,882 (GRCm39) N29K probably damaging Het
Ppp2r2a A G 14: 67,276,318 (GRCm39) probably benign Het
Ptprk A G 10: 28,427,647 (GRCm39) D742G probably damaging Het
Rfxank C A 8: 70,586,953 (GRCm39) R221L possibly damaging Het
Shank3 C A 15: 89,387,866 (GRCm39) Q317K probably benign Het
Slc22a17 A G 14: 55,145,447 (GRCm39) V460A probably damaging Het
Slc39a11 G T 11: 113,450,361 (GRCm39) D41E probably damaging Het
Spag17 T C 3: 99,846,679 (GRCm39) S68P possibly damaging Het
Sstr5 C T 17: 25,710,272 (GRCm39) C319Y possibly damaging Het
Stk17b G T 1: 53,796,749 (GRCm39) D339E probably damaging Het
Tagln2 A G 1: 172,332,788 (GRCm39) D25G probably benign Het
Ttn C T 2: 76,625,194 (GRCm39) V13417I probably benign Het
Vps50 A G 6: 3,545,568 (GRCm39) E334G possibly damaging Het
Zfp316 T C 5: 143,249,849 (GRCm39) E138G unknown Het
Zfp879 T A 11: 50,724,376 (GRCm39) T227S probably benign Het
Other mutations in Pum2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00737:Pum2 APN 12 8,783,381 (GRCm39) missense probably damaging 1.00
IGL02118:Pum2 APN 12 8,779,117 (GRCm39) missense probably benign 0.31
IGL02185:Pum2 APN 12 8,798,955 (GRCm39) critical splice donor site probably null
IGL02528:Pum2 APN 12 8,778,696 (GRCm39) nonsense probably null
IGL02718:Pum2 APN 12 8,783,344 (GRCm39) missense probably benign 0.02
Plumbat UTSW 12 8,778,779 (GRCm39) critical splice donor site probably null
Pummie UTSW 12 8,763,906 (GRCm39) nonsense probably null
Yorkshire UTSW 12 8,778,726 (GRCm39) nonsense probably null
PIT4366001:Pum2 UTSW 12 8,783,390 (GRCm39) missense probably damaging 1.00
R0152:Pum2 UTSW 12 8,778,754 (GRCm39) missense possibly damaging 0.94
R0317:Pum2 UTSW 12 8,778,754 (GRCm39) missense possibly damaging 0.94
R0357:Pum2 UTSW 12 8,771,785 (GRCm39) missense possibly damaging 0.92
R0413:Pum2 UTSW 12 8,763,464 (GRCm39) missense probably benign 0.00
R0494:Pum2 UTSW 12 8,771,736 (GRCm39) nonsense probably null
R0520:Pum2 UTSW 12 8,771,710 (GRCm39) missense probably damaging 1.00
R0727:Pum2 UTSW 12 8,794,465 (GRCm39) missense probably damaging 1.00
R2035:Pum2 UTSW 12 8,778,638 (GRCm39) nonsense probably null
R2060:Pum2 UTSW 12 8,778,726 (GRCm39) nonsense probably null
R2422:Pum2 UTSW 12 8,798,931 (GRCm39) missense possibly damaging 0.70
R2437:Pum2 UTSW 12 8,794,654 (GRCm39) missense probably benign 0.19
R3767:Pum2 UTSW 12 8,769,076 (GRCm39) nonsense probably null
R4715:Pum2 UTSW 12 8,797,272 (GRCm39) missense probably damaging 1.00
R5155:Pum2 UTSW 12 8,763,572 (GRCm39) missense possibly damaging 0.79
R5226:Pum2 UTSW 12 8,763,458 (GRCm39) missense possibly damaging 0.73
R5323:Pum2 UTSW 12 8,794,706 (GRCm39) missense probably damaging 1.00
R6250:Pum2 UTSW 12 8,794,755 (GRCm39) splice site probably null
R6253:Pum2 UTSW 12 8,798,205 (GRCm39) missense probably damaging 1.00
R6508:Pum2 UTSW 12 8,798,861 (GRCm39) missense probably benign 0.17
R6953:Pum2 UTSW 12 8,778,779 (GRCm39) critical splice donor site probably null
R7135:Pum2 UTSW 12 8,778,952 (GRCm39) missense possibly damaging 0.80
R7355:Pum2 UTSW 12 8,763,906 (GRCm39) nonsense probably null
R7586:Pum2 UTSW 12 8,797,206 (GRCm39) missense probably damaging 1.00
R7683:Pum2 UTSW 12 8,778,922 (GRCm39) missense possibly damaging 0.93
R7869:Pum2 UTSW 12 8,763,595 (GRCm39) missense probably benign 0.00
R7873:Pum2 UTSW 12 8,798,802 (GRCm39) missense possibly damaging 0.94
R7980:Pum2 UTSW 12 8,763,904 (GRCm39) missense probably damaging 0.98
R8166:Pum2 UTSW 12 8,771,739 (GRCm39) missense possibly damaging 0.71
R8316:Pum2 UTSW 12 8,763,456 (GRCm39) missense possibly damaging 0.89
R8345:Pum2 UTSW 12 8,759,454 (GRCm39) missense probably damaging 0.99
R8418:Pum2 UTSW 12 8,760,245 (GRCm39) missense possibly damaging 0.87
R8802:Pum2 UTSW 12 8,778,726 (GRCm39) nonsense probably null
R9039:Pum2 UTSW 12 8,794,430 (GRCm39) missense probably damaging 1.00
R9207:Pum2 UTSW 12 8,763,904 (GRCm39) missense probably damaging 0.98
R9366:Pum2 UTSW 12 8,783,344 (GRCm39) missense probably benign 0.02
R9700:Pum2 UTSW 12 8,779,044 (GRCm39) missense probably damaging 0.97
X0039:Pum2 UTSW 12 8,778,944 (GRCm39) small deletion probably benign
Predicted Primers PCR Primer
(F):5'- ACTTAGTCGCACTCCTGGAAGTCG -3'
(R):5'- TGCTGCTAATGCATACTGCTGCTG -3'

Sequencing Primer
(F):5'- ACTCCTGGAAGTCGCCAAG -3'
(R):5'- TAGTCCTCTGAAAGAGCTATCCAG -3'
Posted On 2014-04-13