Incidental Mutation 'R1576:Emilin2'
ID171190
Institutional Source Beutler Lab
Gene Symbol Emilin2
Ensembl Gene ENSMUSG00000024053
Gene Nameelastin microfibril interfacer 2
SynonymsFOAP-10, basilin
MMRRC Submission 039614-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock #R1576 (G1)
Quality Score216
Status Validated
Chromosome17
Chromosomal Location71252176-71310965 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 71255117 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000024849 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024849]
Predicted Effect probably null
Transcript: ENSMUST00000024849
SMART Domains Protein: ENSMUSP00000024849
Gene: ENSMUSG00000024053

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
Pfam:EMI 48 118 1.2e-18 PFAM
coiled coil region 181 216 N/A INTRINSIC
coiled coil region 259 308 N/A INTRINSIC
coiled coil region 590 618 N/A INTRINSIC
low complexity region 809 826 N/A INTRINSIC
low complexity region 833 848 N/A INTRINSIC
low complexity region 914 927 N/A INTRINSIC
Pfam:C1q 928 1067 5.1e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180743
Meta Mutation Damage Score 0.9481 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 92.1%
Validation Efficiency 100% (49/49)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit disruptions in platelet activation, thrombus formation and clot retraction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ap3m2 G A 8: 22,808,467 probably benign Het
Apol11a T A 15: 77,516,931 I206N probably damaging Het
Arfgap3 A G 15: 83,313,563 S331P possibly damaging Het
Arhgef16 A C 4: 154,291,312 L75R probably damaging Het
Cfi T C 3: 129,873,050 V474A probably damaging Het
Dhx8 T C 11: 101,752,319 V739A probably damaging Het
Dpy19l2 T A 9: 24,584,502 H640L probably benign Het
Eif4g3 T A 4: 138,096,870 M57K probably damaging Het
Epc1 T C 18: 6,452,366 E281G possibly damaging Het
Fancd2 G T 6: 113,578,405 S1125I probably damaging Het
Fh1 G A 1: 175,607,819 P366L probably null Het
Gata3 A T 2: 9,863,196 S316T probably damaging Het
Hmcn1 A T 1: 150,657,241 S3064T possibly damaging Het
Inpp5d A T 1: 87,669,685 T193S probably benign Het
Inpp5d A T 1: 87,681,558 I277F probably damaging Het
Itga5 T C 15: 103,351,617 D616G probably damaging Het
Jade1 T A 3: 41,591,807 V89E probably damaging Het
Lamb2 T C 9: 108,480,307 S81P probably damaging Het
Lrrc19 G A 4: 94,639,353 P207L probably damaging Het
Maea A G 5: 33,362,696 D147G probably damaging Het
Muc6 T A 7: 141,634,524 E2767V possibly damaging Het
Myom2 A G 8: 15,084,556 Y453C probably damaging Het
Naip2 A T 13: 100,155,021 D1136E probably benign Het
Naip2 G A 13: 100,155,029 probably benign Het
Nap1l1 A G 10: 111,494,820 D362G probably damaging Het
Nap1l4 C T 7: 143,538,216 probably null Het
Nudt21 A C 8: 94,028,833 probably null Het
Nufip1 A G 14: 76,134,870 N475D probably benign Het
Pcdhb8 A G 18: 37,356,703 D478G probably damaging Het
Pla2g4d A G 2: 120,284,167 S28P probably damaging Het
Polr2j C A 5: 136,120,028 N29K probably damaging Het
Ppp2r2a A G 14: 67,038,869 probably benign Het
Ptprk A G 10: 28,551,651 D742G probably damaging Het
Pum2 A G 12: 8,713,524 D227G probably benign Het
Rfxank C A 8: 70,134,303 R221L possibly damaging Het
Shank3 C A 15: 89,503,663 Q317K probably benign Het
Slc22a17 A G 14: 54,907,990 V460A probably damaging Het
Slc39a11 G T 11: 113,559,535 D41E probably damaging Het
Spag17 T C 3: 99,939,363 S68P possibly damaging Het
Sstr5 C T 17: 25,491,298 C319Y possibly damaging Het
Stk17b G T 1: 53,757,590 D339E probably damaging Het
Tagln2 A G 1: 172,505,221 D25G probably benign Het
Ttn C T 2: 76,794,850 V13417I probably benign Het
Vps50 A G 6: 3,545,568 E334G possibly damaging Het
Zfp316 T C 5: 143,264,094 E138G unknown Het
Zfp879 T A 11: 50,833,549 T227S probably benign Het
Other mutations in Emilin2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00565:Emilin2 APN 17 71252859 missense possibly damaging 0.80
IGL01294:Emilin2 APN 17 71274594 missense probably benign 0.07
IGL02085:Emilin2 APN 17 71275149 missense probably damaging 0.99
IGL02433:Emilin2 APN 17 71274129 missense probably benign
IGL02587:Emilin2 APN 17 71280856 splice site probably benign
IGL02639:Emilin2 APN 17 71274549 missense probably benign 0.00
IGL02798:Emilin2 APN 17 71256695 splice site probably benign
IGL02952:Emilin2 APN 17 71280821 missense probably damaging 0.99
IGL02954:Emilin2 APN 17 71256531 missense probably benign 0.37
PIT4431001:Emilin2 UTSW 17 71255995 missense probably benign 0.16
PIT4802001:Emilin2 UTSW 17 71273469 missense probably damaging 1.00
R0011:Emilin2 UTSW 17 71273868 missense probably benign 0.01
R0033:Emilin2 UTSW 17 71275014 missense probably benign 0.27
R0784:Emilin2 UTSW 17 71275287 missense possibly damaging 0.83
R0830:Emilin2 UTSW 17 71273820 missense probably benign
R1301:Emilin2 UTSW 17 71255965 splice site probably benign
R1394:Emilin2 UTSW 17 71253071 missense possibly damaging 0.79
R1501:Emilin2 UTSW 17 71310761 missense probably benign
R1676:Emilin2 UTSW 17 71274090 missense probably benign 0.14
R2063:Emilin2 UTSW 17 71274955 missense probably benign
R2149:Emilin2 UTSW 17 71273992 missense probably benign 0.06
R2238:Emilin2 UTSW 17 71274739 missense possibly damaging 0.83
R2239:Emilin2 UTSW 17 71310224 missense probably benign 0.00
R2380:Emilin2 UTSW 17 71310224 missense probably benign 0.00
R2420:Emilin2 UTSW 17 71274279 missense possibly damaging 0.90
R3721:Emilin2 UTSW 17 71273454 missense probably benign 0.12
R4176:Emilin2 UTSW 17 71274263 missense probably benign 0.00
R4348:Emilin2 UTSW 17 71280731 missense probably benign
R4352:Emilin2 UTSW 17 71280731 missense probably benign
R4695:Emilin2 UTSW 17 71252778 missense probably damaging 1.00
R4807:Emilin2 UTSW 17 71273448 missense probably damaging 0.98
R4980:Emilin2 UTSW 17 71253071 missense possibly damaging 0.79
R5028:Emilin2 UTSW 17 71274732 missense possibly damaging 0.91
R5048:Emilin2 UTSW 17 71273967 missense probably damaging 1.00
R5153:Emilin2 UTSW 17 71273502 missense possibly damaging 0.83
R5519:Emilin2 UTSW 17 71252935 missense probably benign 0.12
R5580:Emilin2 UTSW 17 71275230 missense probably benign
R6088:Emilin2 UTSW 17 71255124 missense probably benign
R6248:Emilin2 UTSW 17 71274117 missense probably benign 0.04
R6429:Emilin2 UTSW 17 71310956 start gained probably benign
R7085:Emilin2 UTSW 17 71274105 missense probably damaging 1.00
R7260:Emilin2 UTSW 17 71274790 missense probably benign 0.00
R7525:Emilin2 UTSW 17 71274979 missense probably benign
R7671:Emilin2 UTSW 17 71273910 missense probably benign 0.00
R7895:Emilin2 UTSW 17 71273913 missense probably benign 0.03
R8257:Emilin2 UTSW 17 71274000 missense probably benign
R8310:Emilin2 UTSW 17 71255146 missense probably damaging 1.00
R8311:Emilin2 UTSW 17 71255146 missense probably damaging 1.00
X0064:Emilin2 UTSW 17 71280703 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGCTACAGGCACCTTCCAAAGTCC -3'
(R):5'- GAAGATAGGCAGGTCCACATGCTC -3'

Sequencing Primer
(F):5'- TCAGTCCCTTCTGGAGAGAAC -3'
(R):5'- GTCCACATGCTCTGGCTTC -3'
Posted On2014-04-13