Incidental Mutation 'R1576:Epc1'
ID171191
Institutional Source Beutler Lab
Gene Symbol Epc1
Ensembl Gene ENSMUSG00000024240
Gene Nameenhancer of polycomb homolog 1
Synonyms2400007E14Rik, A930032N02Rik, 5730566F07Rik
MMRRC Submission 039614-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1576 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location6435951-6516108 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 6452366 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 281 (E281G)
Ref Sequence ENSEMBL: ENSMUSP00000028100 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028100] [ENSMUST00000115870]
Predicted Effect possibly damaging
Transcript: ENSMUST00000028100
AA Change: E281G

PolyPhen 2 Score 0.486 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000028100
Gene: ENSMUSG00000024240
AA Change: E281G

DomainStartEndE-ValueType
Pfam:EPL1 7 149 7e-14 PFAM
low complexity region 161 170 N/A INTRINSIC
low complexity region 345 361 N/A INTRINSIC
low complexity region 455 465 N/A INTRINSIC
low complexity region 564 577 N/A INTRINSIC
Pfam:E_Pc_C 581 813 1.6e-106 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000115870
AA Change: E231G

PolyPhen 2 Score 0.478 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000111536
Gene: ENSMUSG00000024240
AA Change: E231G

DomainStartEndE-ValueType
Pfam:EPL1 1 99 1.3e-19 PFAM
low complexity region 111 120 N/A INTRINSIC
low complexity region 295 311 N/A INTRINSIC
low complexity region 405 415 N/A INTRINSIC
low complexity region 514 527 N/A INTRINSIC
Pfam:E_Pc_C 531 763 1.7e-110 PFAM
Meta Mutation Damage Score 0.1272 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 92.1%
Validation Efficiency 100% (49/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the polycomb group (PcG) family. The encoded protein is a component of the NuA4 histone acetyltransferase complex and can act as both a transcriptional activator and repressor. The encoded protein has been linked to apoptosis, DNA repair, skeletal muscle differentiation, gene silencing, and adult T-cell leukemia/lymphoma. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2012]
PHENOTYPE: Mice homozygous for a gene trap allele die prior to P10 (no time point given) and heterozygous mice exhibit impaired skeletal muscle differentiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ap3m2 G A 8: 22,808,467 probably benign Het
Apol11a T A 15: 77,516,931 I206N probably damaging Het
Arfgap3 A G 15: 83,313,563 S331P possibly damaging Het
Arhgef16 A C 4: 154,291,312 L75R probably damaging Het
Cfi T C 3: 129,873,050 V474A probably damaging Het
Dhx8 T C 11: 101,752,319 V739A probably damaging Het
Dpy19l2 T A 9: 24,584,502 H640L probably benign Het
Eif4g3 T A 4: 138,096,870 M57K probably damaging Het
Emilin2 A G 17: 71,255,117 probably null Het
Fancd2 G T 6: 113,578,405 S1125I probably damaging Het
Fh1 G A 1: 175,607,819 P366L probably null Het
Gata3 A T 2: 9,863,196 S316T probably damaging Het
Hmcn1 A T 1: 150,657,241 S3064T possibly damaging Het
Inpp5d A T 1: 87,681,558 I277F probably damaging Het
Inpp5d A T 1: 87,669,685 T193S probably benign Het
Itga5 T C 15: 103,351,617 D616G probably damaging Het
Jade1 T A 3: 41,591,807 V89E probably damaging Het
Lamb2 T C 9: 108,480,307 S81P probably damaging Het
Lrrc19 G A 4: 94,639,353 P207L probably damaging Het
Maea A G 5: 33,362,696 D147G probably damaging Het
Muc6 T A 7: 141,634,524 E2767V possibly damaging Het
Myom2 A G 8: 15,084,556 Y453C probably damaging Het
Naip2 A T 13: 100,155,021 D1136E probably benign Het
Naip2 G A 13: 100,155,029 probably benign Het
Nap1l1 A G 10: 111,494,820 D362G probably damaging Het
Nap1l4 C T 7: 143,538,216 probably null Het
Nudt21 A C 8: 94,028,833 probably null Het
Nufip1 A G 14: 76,134,870 N475D probably benign Het
Pcdhb8 A G 18: 37,356,703 D478G probably damaging Het
Pla2g4d A G 2: 120,284,167 S28P probably damaging Het
Polr2j C A 5: 136,120,028 N29K probably damaging Het
Ppp2r2a A G 14: 67,038,869 probably benign Het
Ptprk A G 10: 28,551,651 D742G probably damaging Het
Pum2 A G 12: 8,713,524 D227G probably benign Het
Rfxank C A 8: 70,134,303 R221L possibly damaging Het
Shank3 C A 15: 89,503,663 Q317K probably benign Het
Slc22a17 A G 14: 54,907,990 V460A probably damaging Het
Slc39a11 G T 11: 113,559,535 D41E probably damaging Het
Spag17 T C 3: 99,939,363 S68P possibly damaging Het
Sstr5 C T 17: 25,491,298 C319Y possibly damaging Het
Stk17b G T 1: 53,757,590 D339E probably damaging Het
Tagln2 A G 1: 172,505,221 D25G probably benign Het
Ttn C T 2: 76,794,850 V13417I probably benign Het
Vps50 A G 6: 3,545,568 E334G possibly damaging Het
Zfp316 T C 5: 143,264,094 E138G unknown Het
Zfp879 T A 11: 50,833,549 T227S probably benign Het
Other mutations in Epc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00516:Epc1 APN 18 6450515 missense probably damaging 1.00
IGL00930:Epc1 APN 18 6449196 missense probably benign
IGL01637:Epc1 APN 18 6439724 missense probably benign 0.22
IGL01929:Epc1 APN 18 6449217 missense possibly damaging 0.94
IGL01993:Epc1 APN 18 6449136 missense possibly damaging 0.83
IGL02234:Epc1 APN 18 6439938 missense probably damaging 1.00
IGL02262:Epc1 APN 18 6437278 missense probably damaging 1.00
IGL02746:Epc1 APN 18 6454317 missense probably benign 0.09
PIT4131001:Epc1 UTSW 18 6449246 missense probably damaging 1.00
R0101:Epc1 UTSW 18 6462998 splice site probably benign
R0230:Epc1 UTSW 18 6440168 missense probably damaging 1.00
R0310:Epc1 UTSW 18 6440202 splice site probably benign
R0959:Epc1 UTSW 18 6453657 missense probably damaging 1.00
R1172:Epc1 UTSW 18 6490525 missense probably damaging 0.99
R1445:Epc1 UTSW 18 6452360 missense probably damaging 1.00
R1640:Epc1 UTSW 18 6441175 nonsense probably null
R2128:Epc1 UTSW 18 6462954 missense probably damaging 1.00
R3763:Epc1 UTSW 18 6440091 missense possibly damaging 0.81
R3883:Epc1 UTSW 18 6452258 missense possibly damaging 0.67
R4184:Epc1 UTSW 18 6453578 missense possibly damaging 0.65
R4258:Epc1 UTSW 18 6450130 missense probably benign 0.21
R4585:Epc1 UTSW 18 6441157 nonsense probably null
R4586:Epc1 UTSW 18 6449138 missense possibly damaging 0.88
R4894:Epc1 UTSW 18 6449011 missense probably benign
R5305:Epc1 UTSW 18 6490690 intron probably benign
R5314:Epc1 UTSW 18 6462969 missense probably damaging 1.00
R5335:Epc1 UTSW 18 6490689 intron probably benign
R5344:Epc1 UTSW 18 6450614 missense probably benign 0.03
R5620:Epc1 UTSW 18 6448917 missense probably benign 0.01
R7567:Epc1 UTSW 18 6450084 missense probably damaging 1.00
R8129:Epc1 UTSW 18 6439634 missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- GGCCTCTAATCACGCCATTCATCAC -3'
(R):5'- ATTTTATCCCACCTACAGCAGGCAC -3'

Sequencing Primer
(F):5'- TCCAGAACACCTTGCAGTG -3'
(R):5'- CACACATGTATCTGAGGATGTGG -3'
Posted On2014-04-13