Incidental Mutation 'R1576:Pcdhb8'
ID171192
Institutional Source Beutler Lab
Gene Symbol Pcdhb8
Ensembl Gene ENSMUSG00000045876
Gene Nameprotocadherin beta 8
SynonymsPcdhb5C, PcdhbH
MMRRC Submission 039614-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.067) question?
Stock #R1576 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location37355121-37358604 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 37356703 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 478 (D478G)
Ref Sequence ENSEMBL: ENSMUSP00000054371 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051163] [ENSMUST00000115661] [ENSMUST00000192867] [ENSMUST00000194544]
Predicted Effect probably damaging
Transcript: ENSMUST00000051163
AA Change: D478G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000054371
Gene: ENSMUSG00000045876
AA Change: D478G

DomainStartEndE-ValueType
Pfam:Cadherin_2 30 112 6.6e-33 PFAM
CA 155 240 7.79e-22 SMART
CA 264 344 3.02e-28 SMART
CA 367 448 1.14e-23 SMART
CA 472 558 9.51e-26 SMART
CA 588 669 5.65e-10 SMART
Pfam:Cadherin_C_2 685 768 1.1e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115661
SMART Domains Protein: ENSMUSP00000111325
Gene: ENSMUSG00000103458

DomainStartEndE-ValueType
CA 20 131 5.3e-2 SMART
CA 155 240 1.51e-19 SMART
CA 264 348 7.6e-25 SMART
CA 372 453 1.42e-24 SMART
CA 477 563 1.42e-24 SMART
CA 594 674 4.12e-12 SMART
low complexity region 706 721 N/A INTRINSIC
Pfam:Cadherin_tail 796 930 3.9e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000192867
SMART Domains Protein: ENSMUSP00000141814
Gene: ENSMUSG00000045876

DomainStartEndE-ValueType
CA 26 104 7e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000193984
Predicted Effect probably benign
Transcript: ENSMUST00000194544
SMART Domains Protein: ENSMUSP00000141847
Gene: ENSMUSG00000102836

DomainStartEndE-ValueType
Blast:CA 18 66 5e-20 BLAST
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 92.1%
Validation Efficiency 100% (49/49)
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ap3m2 G A 8: 22,808,467 probably benign Het
Apol11a T A 15: 77,516,931 I206N probably damaging Het
Arfgap3 A G 15: 83,313,563 S331P possibly damaging Het
Arhgef16 A C 4: 154,291,312 L75R probably damaging Het
Cfi T C 3: 129,873,050 V474A probably damaging Het
Dhx8 T C 11: 101,752,319 V739A probably damaging Het
Dpy19l2 T A 9: 24,584,502 H640L probably benign Het
Eif4g3 T A 4: 138,096,870 M57K probably damaging Het
Emilin2 A G 17: 71,255,117 probably null Het
Epc1 T C 18: 6,452,366 E281G possibly damaging Het
Fancd2 G T 6: 113,578,405 S1125I probably damaging Het
Fh1 G A 1: 175,607,819 P366L probably null Het
Gata3 A T 2: 9,863,196 S316T probably damaging Het
Hmcn1 A T 1: 150,657,241 S3064T possibly damaging Het
Inpp5d A T 1: 87,669,685 T193S probably benign Het
Inpp5d A T 1: 87,681,558 I277F probably damaging Het
Itga5 T C 15: 103,351,617 D616G probably damaging Het
Jade1 T A 3: 41,591,807 V89E probably damaging Het
Lamb2 T C 9: 108,480,307 S81P probably damaging Het
Lrrc19 G A 4: 94,639,353 P207L probably damaging Het
Maea A G 5: 33,362,696 D147G probably damaging Het
Muc6 T A 7: 141,634,524 E2767V possibly damaging Het
Myom2 A G 8: 15,084,556 Y453C probably damaging Het
Naip2 A T 13: 100,155,021 D1136E probably benign Het
Naip2 G A 13: 100,155,029 probably benign Het
Nap1l1 A G 10: 111,494,820 D362G probably damaging Het
Nap1l4 C T 7: 143,538,216 probably null Het
Nudt21 A C 8: 94,028,833 probably null Het
Nufip1 A G 14: 76,134,870 N475D probably benign Het
Pla2g4d A G 2: 120,284,167 S28P probably damaging Het
Polr2j C A 5: 136,120,028 N29K probably damaging Het
Ppp2r2a A G 14: 67,038,869 probably benign Het
Ptprk A G 10: 28,551,651 D742G probably damaging Het
Pum2 A G 12: 8,713,524 D227G probably benign Het
Rfxank C A 8: 70,134,303 R221L possibly damaging Het
Shank3 C A 15: 89,503,663 Q317K probably benign Het
Slc22a17 A G 14: 54,907,990 V460A probably damaging Het
Slc39a11 G T 11: 113,559,535 D41E probably damaging Het
Spag17 T C 3: 99,939,363 S68P possibly damaging Het
Sstr5 C T 17: 25,491,298 C319Y possibly damaging Het
Stk17b G T 1: 53,757,590 D339E probably damaging Het
Tagln2 A G 1: 172,505,221 D25G probably benign Het
Ttn C T 2: 76,794,850 V13417I probably benign Het
Vps50 A G 6: 3,545,568 E334G possibly damaging Het
Zfp316 T C 5: 143,264,094 E138G unknown Het
Zfp879 T A 11: 50,833,549 T227S probably benign Het
Other mutations in Pcdhb8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00264:Pcdhb8 APN 18 37355473 missense probably benign 0.00
IGL00574:Pcdhb8 APN 18 37356370 missense probably damaging 1.00
IGL00960:Pcdhb8 APN 18 37355973 missense probably benign 0.28
IGL01103:Pcdhb8 APN 18 37357200 missense probably damaging 1.00
IGL01330:Pcdhb8 APN 18 37357578 missense probably benign 0.12
IGL01413:Pcdhb8 APN 18 37355976 missense probably damaging 1.00
IGL01418:Pcdhb8 APN 18 37355976 missense probably damaging 1.00
IGL01608:Pcdhb8 APN 18 37356925 missense probably damaging 1.00
IGL02212:Pcdhb8 APN 18 37356412 missense possibly damaging 0.95
IGL02582:Pcdhb8 APN 18 37355374 missense possibly damaging 0.79
IGL02607:Pcdhb8 APN 18 37357581 missense probably benign 0.00
IGL02882:Pcdhb8 APN 18 37356223 missense possibly damaging 0.95
IGL03005:Pcdhb8 APN 18 37357534 missense probably damaging 1.00
IGL03108:Pcdhb8 APN 18 37357246 missense probably damaging 1.00
PIT4468001:Pcdhb8 UTSW 18 37356633 missense probably damaging 1.00
R0104:Pcdhb8 UTSW 18 37355665 missense probably benign 0.01
R0490:Pcdhb8 UTSW 18 37356780 missense probably damaging 1.00
R0617:Pcdhb8 UTSW 18 37357047 missense probably benign 0.02
R1168:Pcdhb8 UTSW 18 37356727 missense probably benign
R1189:Pcdhb8 UTSW 18 37356567 nonsense probably null
R1232:Pcdhb8 UTSW 18 37355775 missense probably benign 0.28
R1503:Pcdhb8 UTSW 18 37356519 missense probably damaging 1.00
R1731:Pcdhb8 UTSW 18 37355838 missense probably damaging 1.00
R1908:Pcdhb8 UTSW 18 37355962 missense possibly damaging 0.84
R1909:Pcdhb8 UTSW 18 37355962 missense possibly damaging 0.84
R2215:Pcdhb8 UTSW 18 37357074 missense probably damaging 0.98
R3080:Pcdhb8 UTSW 18 37356166 missense probably damaging 1.00
R4394:Pcdhb8 UTSW 18 37356882 missense probably damaging 1.00
R4799:Pcdhb8 UTSW 18 37355653 missense probably damaging 1.00
R4845:Pcdhb8 UTSW 18 37356718 missense probably benign 0.43
R4879:Pcdhb8 UTSW 18 37356166 missense probably damaging 1.00
R4941:Pcdhb8 UTSW 18 37356006 missense probably benign 0.03
R5086:Pcdhb8 UTSW 18 37356106 missense probably damaging 1.00
R5416:Pcdhb8 UTSW 18 37356955 missense probably damaging 1.00
R5774:Pcdhb8 UTSW 18 37356685 missense probably damaging 1.00
R5898:Pcdhb8 UTSW 18 37357484 missense possibly damaging 0.92
R5935:Pcdhb8 UTSW 18 37356190 missense probably damaging 1.00
R6191:Pcdhb8 UTSW 18 37356226 missense probably benign
R6228:Pcdhb8 UTSW 18 37356984 missense probably benign 0.05
R6245:Pcdhb8 UTSW 18 37357169 missense possibly damaging 0.80
R6397:Pcdhb8 UTSW 18 37355463 nonsense probably null
R7469:Pcdhb8 UTSW 18 37355958 missense probably damaging 1.00
R7632:Pcdhb8 UTSW 18 37355595 missense probably benign 0.00
R8323:Pcdhb8 UTSW 18 37355423 missense probably benign 0.23
Predicted Primers PCR Primer
(F):5'- AGAGAGCAACGCTGAGTACAACATC -3'
(R):5'- GCATTGTCATTGTCATCCAGCACC -3'

Sequencing Primer
(F):5'- TCACAATCACGGTCTCTGAC -3'
(R):5'- AGAGCCTCTGAGCTGAGC -3'
Posted On2014-04-13