Incidental Mutation 'R1577:Gal3st2c'
ID171196
Institutional Source Beutler Lab
Gene Symbol Gal3st2c
Ensembl Gene ENSMUSG00000073608
Gene Namegalactose-3-O-sulfotransferase 2C
SynonymsGm6086
MMRRC Submission 039615-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.112) question?
Stock #R1577 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location93990509-94017147 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 94006928 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 13 (V13M)
Ref Sequence ENSEMBL: ENSMUSP00000095234 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097632]
Predicted Effect probably damaging
Transcript: ENSMUST00000097632
AA Change: V13M

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000095234
Gene: ENSMUSG00000073608
AA Change: V13M

DomainStartEndE-ValueType
Pfam:Gal-3-0_sulfotr 1 382 8.4e-150 PFAM
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.8%
  • 10x: 94.6%
  • 20x: 87.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb3 T C 1: 25,094,183 N404S possibly damaging Het
Cep85 T C 4: 134,152,288 E383G probably damaging Het
Chst4 A T 8: 110,029,844 H379Q probably benign Het
Clca3b A T 3: 144,823,519 I798N probably damaging Het
Cldnd1 T G 16: 58,732,653 L159R possibly damaging Het
Cntnap3 T C 13: 64,758,290 E834G probably damaging Het
Col2a1 C T 15: 97,979,202 R1065Q probably damaging Het
Dchs1 T C 7: 105,765,955 D674G probably damaging Het
Dntt A G 19: 41,055,785 Y463C probably damaging Het
Egfr A G 11: 16,869,241 E257G probably benign Het
Eif4b C T 15: 102,089,901 R339* probably null Het
Fat1 C T 8: 45,023,383 T1822M probably benign Het
Fgd3 T C 13: 49,281,937 N282D probably damaging Het
Fmo4 T C 1: 162,803,700 M233V possibly damaging Het
Gabbr2 T A 4: 46,684,319 M652L probably benign Het
Gapvd1 C T 2: 34,709,228 G686D probably damaging Het
Gdap1l1 T G 2: 163,438,604 L20R probably damaging Het
Gm5800 A T 14: 51,714,559 M82K probably benign Het
Grm6 T A 11: 50,863,145 C759S probably damaging Het
Hs3st1 A T 5: 39,615,050 D83E probably benign Het
Il12rb1 A G 8: 70,810,606 D39G probably damaging Het
Ldhb C A 6: 142,492,598 K244N possibly damaging Het
Lypd6 C T 2: 50,190,698 R133* probably null Het
Med13l G A 5: 118,721,392 G215S probably damaging Het
Ncoa1 T C 12: 4,295,196 D606G probably damaging Het
Noc2l C T 4: 156,240,622 T151M probably damaging Het
Olfr1107 T C 2: 87,071,397 T246A probably benign Het
Olfr1395 T A 11: 49,149,189 C311S probably benign Het
Olfr1419 T C 19: 11,870,377 T280A probably damaging Het
Olfr520 T C 7: 99,735,356 L71P probably damaging Het
Olfr706 T C 7: 106,886,010 K269R probably benign Het
Ppm1l G A 3: 69,553,070 G327R probably damaging Het
Rapgef5 C T 12: 117,595,291 A282V probably benign Het
Rnf139 T C 15: 58,899,518 V464A probably damaging Het
Rprd2 C T 3: 95,764,735 E1119K probably damaging Het
Sipa1l2 G A 8: 125,492,262 T112I probably benign Het
Skint6 T C 4: 113,148,523 T363A possibly damaging Het
Slc22a16 G T 10: 40,603,815 E607* probably null Het
Slc24a2 T C 4: 86,991,411 Y690C probably damaging Het
Slc25a23 T C 17: 57,047,306 S115G probably benign Het
Slc4a3 T C 1: 75,550,891 L168P probably damaging Het
Spats2 T A 15: 99,178,452 I137N possibly damaging Het
Stard4 A T 18: 33,205,098 V133D probably damaging Het
Syn3 A G 10: 86,448,864 probably null Het
Tfpi A G 2: 84,433,103 I305T probably damaging Het
Tmtc1 T A 6: 148,412,820 probably null Het
Tpcn1 A C 5: 120,544,420 W508G probably damaging Het
Ubr5 A T 15: 38,030,730 N406K possibly damaging Het
Xrcc1 T A 7: 24,565,627 L118* probably null Het
Zbtb5 T C 4: 44,995,129 Y85C probably damaging Het
Zfand4 C A 6: 116,329,412 Y735* probably null Het
Zfp180 G T 7: 24,105,908 C584F probably damaging Het
Other mutations in Gal3st2c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00468:Gal3st2c APN 1 94009049 missense probably benign 0.38
IGL01469:Gal3st2c APN 1 94009317 missense probably benign 0.18
PIT4431001:Gal3st2c UTSW 1 94008112 missense probably damaging 1.00
R0110:Gal3st2c UTSW 1 94009497 missense probably benign 0.03
R0602:Gal3st2c UTSW 1 94009179 missense probably damaging 1.00
R0846:Gal3st2c UTSW 1 94006947 missense possibly damaging 0.51
R1900:Gal3st2c UTSW 1 94009044 missense probably damaging 1.00
R1902:Gal3st2c UTSW 1 94008889 missense probably damaging 1.00
R2143:Gal3st2c UTSW 1 94009451 nonsense probably null
R2846:Gal3st2c UTSW 1 93996400 missense possibly damaging 0.52
R3737:Gal3st2c UTSW 1 94009328 missense possibly damaging 0.79
R4236:Gal3st2c UTSW 1 94008741 missense probably damaging 1.00
R4623:Gal3st2c UTSW 1 94009456 missense possibly damaging 0.59
R5177:Gal3st2c UTSW 1 94009208 nonsense probably null
R5590:Gal3st2c UTSW 1 94008301 critical splice donor site probably null
R7529:Gal3st2c UTSW 1 94009317 missense probably benign 0.18
R7559:Gal3st2c UTSW 1 94009353 missense probably damaging 1.00
Z1088:Gal3st2c UTSW 1 94008145 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TGGATCTCTCCAGGGCTTGAAGAC -3'
(R):5'- TGTGTGCATTAAGCAGGTAGGACAG -3'

Sequencing Primer
(F):5'- tgggtgtggtgaggaagg -3'
(R):5'- ATCTGCACAGGACTTACGGT -3'
Posted On2014-04-13