Incidental Mutation 'R1577:Gapvd1'
Institutional Source Beutler Lab
Gene Symbol Gapvd1
Ensembl Gene ENSMUSG00000026867
Gene NameGTPase activating protein and VPS9 domains 1
Synonyms4432404J10Rik, 2010005B09Rik
MMRRC Submission 039615-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1577 (G1)
Quality Score225
Status Not validated
Chromosomal Location34674594-34755232 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 34709228 bp
Amino Acid Change Glycine to Aspartic acid at position 686 (G686D)
Ref Sequence ENSEMBL: ENSMUSP00000108723 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028224] [ENSMUST00000102800] [ENSMUST00000113099]
Predicted Effect probably damaging
Transcript: ENSMUST00000028224
AA Change: G665D

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000028224
Gene: ENSMUSG00000026867
AA Change: G665D

Pfam:RasGAP 152 353 2.3e-36 PFAM
internal_repeat_1 626 655 3.27e-5 PROSPERO
low complexity region 664 678 N/A INTRINSIC
internal_repeat_1 686 717 3.27e-5 PROSPERO
low complexity region 875 890 N/A INTRINSIC
low complexity region 909 920 N/A INTRINSIC
low complexity region 923 933 N/A INTRINSIC
low complexity region 936 952 N/A INTRINSIC
low complexity region 972 982 N/A INTRINSIC
VPS9 1332 1437 1.08e-24 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000102800
AA Change: G665D

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000099864
Gene: ENSMUSG00000026867
AA Change: G665D

Pfam:RasGAP 152 353 2.3e-36 PFAM
internal_repeat_1 626 655 3.27e-5 PROSPERO
low complexity region 664 678 N/A INTRINSIC
internal_repeat_1 686 717 3.27e-5 PROSPERO
low complexity region 875 890 N/A INTRINSIC
low complexity region 909 920 N/A INTRINSIC
low complexity region 923 933 N/A INTRINSIC
low complexity region 936 952 N/A INTRINSIC
low complexity region 972 982 N/A INTRINSIC
VPS9 1332 1437 1.08e-24 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000113099
AA Change: G686D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108723
Gene: ENSMUSG00000026867
AA Change: G686D

Pfam:RasGAP 152 353 2.8e-37 PFAM
internal_repeat_1 647 676 3.6e-5 PROSPERO
low complexity region 685 699 N/A INTRINSIC
internal_repeat_1 707 738 3.6e-5 PROSPERO
low complexity region 896 911 N/A INTRINSIC
low complexity region 930 941 N/A INTRINSIC
low complexity region 944 954 N/A INTRINSIC
low complexity region 957 973 N/A INTRINSIC
low complexity region 993 1003 N/A INTRINSIC
VPS9 1353 1458 1.08e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113101
SMART Domains Protein: ENSMUSP00000108725
Gene: ENSMUSG00000026867

low complexity region 13 28 N/A INTRINSIC
low complexity region 47 58 N/A INTRINSIC
low complexity region 61 71 N/A INTRINSIC
low complexity region 74 90 N/A INTRINSIC
VPS9 443 548 1.08e-24 SMART
Predicted Effect unknown
Transcript: ENSMUST00000113103
AA Change: G522D
SMART Domains Protein: ENSMUSP00000108727
Gene: ENSMUSG00000026867
AA Change: G522D

Pfam:RasGAP 1 184 4.9e-32 PFAM
internal_repeat_1 484 513 1.18e-5 PROSPERO
low complexity region 522 536 N/A INTRINSIC
internal_repeat_1 544 575 1.18e-5 PROSPERO
low complexity region 733 748 N/A INTRINSIC
low complexity region 767 778 N/A INTRINSIC
low complexity region 781 791 N/A INTRINSIC
low complexity region 794 810 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000113111
AA Change: G123D
SMART Domains Protein: ENSMUSP00000108735
Gene: ENSMUSG00000026867
AA Change: G123D

internal_repeat_1 85 114 3.65e-6 PROSPERO
low complexity region 123 137 N/A INTRINSIC
internal_repeat_1 145 176 3.65e-6 PROSPERO
low complexity region 334 349 N/A INTRINSIC
low complexity region 368 379 N/A INTRINSIC
low complexity region 382 392 N/A INTRINSIC
low complexity region 395 411 N/A INTRINSIC
low complexity region 431 441 N/A INTRINSIC
VPS9 791 896 1.08e-24 SMART
Predicted Effect unknown
Transcript: ENSMUST00000128855
AA Change: G26D
SMART Domains Protein: ENSMUSP00000129138
Gene: ENSMUSG00000026867
AA Change: G26D

low complexity region 26 40 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000137528
AA Change: G548D
SMART Domains Protein: ENSMUSP00000120138
Gene: ENSMUSG00000026867
AA Change: G548D

Pfam:RasGAP 15 216 1.2e-37 PFAM
internal_repeat_1 510 539 1.19e-5 PROSPERO
low complexity region 548 562 N/A INTRINSIC
internal_repeat_1 570 601 1.19e-5 PROSPERO
low complexity region 733 748 N/A INTRINSIC
low complexity region 767 778 N/A INTRINSIC
low complexity region 781 791 N/A INTRINSIC
low complexity region 794 810 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150859
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156098
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167251
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.8%
  • 10x: 94.6%
  • 20x: 87.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb3 T C 1: 25,094,183 N404S possibly damaging Het
Cep85 T C 4: 134,152,288 E383G probably damaging Het
Chst4 A T 8: 110,029,844 H379Q probably benign Het
Clca3b A T 3: 144,823,519 I798N probably damaging Het
Cldnd1 T G 16: 58,732,653 L159R possibly damaging Het
Cntnap3 T C 13: 64,758,290 E834G probably damaging Het
Col2a1 C T 15: 97,979,202 R1065Q probably damaging Het
Dchs1 T C 7: 105,765,955 D674G probably damaging Het
Dntt A G 19: 41,055,785 Y463C probably damaging Het
Egfr A G 11: 16,869,241 E257G probably benign Het
Eif4b C T 15: 102,089,901 R339* probably null Het
Fat1 C T 8: 45,023,383 T1822M probably benign Het
Fgd3 T C 13: 49,281,937 N282D probably damaging Het
Fmo4 T C 1: 162,803,700 M233V possibly damaging Het
Gabbr2 T A 4: 46,684,319 M652L probably benign Het
Gal3st2c G A 1: 94,006,928 V13M probably damaging Het
Gdap1l1 T G 2: 163,438,604 L20R probably damaging Het
Gm5800 A T 14: 51,714,559 M82K probably benign Het
Grm6 T A 11: 50,863,145 C759S probably damaging Het
Hs3st1 A T 5: 39,615,050 D83E probably benign Het
Il12rb1 A G 8: 70,810,606 D39G probably damaging Het
Ldhb C A 6: 142,492,598 K244N possibly damaging Het
Lypd6 C T 2: 50,190,698 R133* probably null Het
Med13l G A 5: 118,721,392 G215S probably damaging Het
Ncoa1 T C 12: 4,295,196 D606G probably damaging Het
Noc2l C T 4: 156,240,622 T151M probably damaging Het
Olfr1107 T C 2: 87,071,397 T246A probably benign Het
Olfr1395 T A 11: 49,149,189 C311S probably benign Het
Olfr1419 T C 19: 11,870,377 T280A probably damaging Het
Olfr520 T C 7: 99,735,356 L71P probably damaging Het
Olfr706 T C 7: 106,886,010 K269R probably benign Het
Ppm1l G A 3: 69,553,070 G327R probably damaging Het
Rapgef5 C T 12: 117,595,291 A282V probably benign Het
Rnf139 T C 15: 58,899,518 V464A probably damaging Het
Rprd2 C T 3: 95,764,735 E1119K probably damaging Het
Sipa1l2 G A 8: 125,492,262 T112I probably benign Het
Skint6 T C 4: 113,148,523 T363A possibly damaging Het
Slc22a16 G T 10: 40,603,815 E607* probably null Het
Slc24a2 T C 4: 86,991,411 Y690C probably damaging Het
Slc25a23 T C 17: 57,047,306 S115G probably benign Het
Slc4a3 T C 1: 75,550,891 L168P probably damaging Het
Spats2 T A 15: 99,178,452 I137N possibly damaging Het
Stard4 A T 18: 33,205,098 V133D probably damaging Het
Syn3 A G 10: 86,448,864 probably null Het
Tfpi A G 2: 84,433,103 I305T probably damaging Het
Tmtc1 T A 6: 148,412,820 probably null Het
Tpcn1 A C 5: 120,544,420 W508G probably damaging Het
Ubr5 A T 15: 38,030,730 N406K possibly damaging Het
Xrcc1 T A 7: 24,565,627 L118* probably null Het
Zbtb5 T C 4: 44,995,129 Y85C probably damaging Het
Zfand4 C A 6: 116,329,412 Y735* probably null Het
Zfp180 G T 7: 24,105,908 C584F probably damaging Het
Other mutations in Gapvd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00799:Gapvd1 APN 2 34699860 missense probably benign 0.00
IGL00985:Gapvd1 APN 2 34695563 missense probably damaging 0.99
IGL01133:Gapvd1 APN 2 34725398 missense probably damaging 0.98
IGL01347:Gapvd1 APN 2 34706696 critical splice donor site probably null
IGL01830:Gapvd1 APN 2 34688956 missense probably benign 0.44
IGL01865:Gapvd1 APN 2 34695503 missense probably null
IGL02009:Gapvd1 APN 2 34704191 missense probably damaging 1.00
IGL02014:Gapvd1 APN 2 34704191 missense probably damaging 1.00
IGL02189:Gapvd1 APN 2 34728544 missense probably damaging 1.00
IGL02418:Gapvd1 APN 2 34730518 missense probably benign 0.00
IGL02632:Gapvd1 APN 2 34684174 splice site probably benign
IGL02636:Gapvd1 APN 2 34725404 missense probably benign 0.01
IGL02643:Gapvd1 APN 2 34704180 missense probably damaging 1.00
IGL03271:Gapvd1 APN 2 34727207 unclassified probably benign
P0023:Gapvd1 UTSW 2 34706688 splice site probably benign
R0016:Gapvd1 UTSW 2 34699913 splice site probably benign
R0016:Gapvd1 UTSW 2 34699913 splice site probably benign
R0029:Gapvd1 UTSW 2 34678141 missense probably damaging 1.00
R0029:Gapvd1 UTSW 2 34678141 missense probably damaging 1.00
R0282:Gapvd1 UTSW 2 34688960 nonsense probably null
R0414:Gapvd1 UTSW 2 34693427 missense probably benign 0.14
R0443:Gapvd1 UTSW 2 34704621 intron probably benign
R0542:Gapvd1 UTSW 2 34725036 unclassified probably benign
R0570:Gapvd1 UTSW 2 34728540 missense probably damaging 1.00
R0840:Gapvd1 UTSW 2 34729113 missense probably benign 0.29
R0866:Gapvd1 UTSW 2 34709217 missense probably damaging 1.00
R0890:Gapvd1 UTSW 2 34712317 missense probably damaging 1.00
R0926:Gapvd1 UTSW 2 34712325 missense probably damaging 1.00
R0970:Gapvd1 UTSW 2 34730613 splice site probably null
R1168:Gapvd1 UTSW 2 34704469 missense probably damaging 1.00
R1391:Gapvd1 UTSW 2 34706802 missense probably damaging 1.00
R1585:Gapvd1 UTSW 2 34712195 missense possibly damaging 0.93
R1669:Gapvd1 UTSW 2 34730682 critical splice acceptor site probably null
R1677:Gapvd1 UTSW 2 34700761 critical splice donor site probably null
R1812:Gapvd1 UTSW 2 34725064 nonsense probably null
R1874:Gapvd1 UTSW 2 34706021 missense probably damaging 1.00
R1878:Gapvd1 UTSW 2 34725200 missense probably benign 0.00
R1974:Gapvd1 UTSW 2 34700841 missense probably damaging 0.99
R2111:Gapvd1 UTSW 2 34684317 missense probably benign 0.08
R2921:Gapvd1 UTSW 2 34688863 missense probably damaging 0.97
R2923:Gapvd1 UTSW 2 34688863 missense probably damaging 0.97
R3846:Gapvd1 UTSW 2 34729072 nonsense probably null
R3894:Gapvd1 UTSW 2 34728476 missense probably benign 0.23
R4405:Gapvd1 UTSW 2 34728735 missense probably damaging 1.00
R4605:Gapvd1 UTSW 2 34728537 missense probably damaging 1.00
R4770:Gapvd1 UTSW 2 34691181 missense probably damaging 0.98
R4935:Gapvd1 UTSW 2 34704492 nonsense probably null
R5218:Gapvd1 UTSW 2 34728476 missense probably benign 0.23
R5490:Gapvd1 UTSW 2 34693433 missense probably benign 0.23
R5571:Gapvd1 UTSW 2 34715253 missense probably damaging 1.00
R5588:Gapvd1 UTSW 2 34709154 missense probably damaging 1.00
R5933:Gapvd1 UTSW 2 34684291 missense probably benign 0.27
R6117:Gapvd1 UTSW 2 34690459 splice site probably null
R6661:Gapvd1 UTSW 2 34728438 missense probably damaging 1.00
R6857:Gapvd1 UTSW 2 34728377 missense probably damaging 1.00
R6950:Gapvd1 UTSW 2 34684245 missense probably benign 0.04
R7009:Gapvd1 UTSW 2 34700817 missense probably damaging 1.00
R7125:Gapvd1 UTSW 2 34695600 missense probably benign
R7154:Gapvd1 UTSW 2 34725063 missense probably damaging 1.00
R7316:Gapvd1 UTSW 2 34704669 missense probably damaging 1.00
R7358:Gapvd1 UTSW 2 34690461 critical splice donor site probably null
R7363:Gapvd1 UTSW 2 34712195 missense probably benign 0.01
R7371:Gapvd1 UTSW 2 34717373 missense probably benign
R7418:Gapvd1 UTSW 2 34725118 missense probably benign 0.12
R7690:Gapvd1 UTSW 2 34729122 missense possibly damaging 0.68
R7740:Gapvd1 UTSW 2 34700822 missense probably damaging 1.00
R7742:Gapvd1 UTSW 2 34678623 missense probably damaging 1.00
R7857:Gapvd1 UTSW 2 34729067 missense probably benign 0.06
R8062:Gapvd1 UTSW 2 34678114 missense probably benign 0.37
R8113:Gapvd1 UTSW 2 34704318 missense probably damaging 0.98
R8303:Gapvd1 UTSW 2 34712200 missense probably damaging 1.00
R8558:Gapvd1 UTSW 2 34704481 missense probably damaging 1.00
R8751:Gapvd1 UTSW 2 34678066 missense probably damaging 0.96
R8781:Gapvd1 UTSW 2 34720686 missense probably benign 0.37
R8794:Gapvd1 UTSW 2 34704318 missense possibly damaging 0.49
R8876:Gapvd1 UTSW 2 34678548 missense possibly damaging 0.95
Z1177:Gapvd1 UTSW 2 34699864 missense possibly damaging 0.78
Predicted Primers PCR Primer
(F):5'- AGTGTTCTAGTgggctggagagatg -3'

Sequencing Primer
(F):5'- aggtgctgaggtaaatgtctg -3'
Posted On2014-04-13