Incidental Mutation 'R1577:Tfpi'
ID171200
Institutional Source Beutler Lab
Gene Symbol Tfpi
Ensembl Gene ENSMUSG00000027082
Gene Nametissue factor pathway inhibitor
Synonyms
MMRRC Submission 039615-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1577 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location84432855-84476775 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 84433103 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 305 (I305T)
Ref Sequence ENSEMBL: ENSMUSP00000107347 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028487] [ENSMUST00000111718] [ENSMUST00000111722]
Predicted Effect probably damaging
Transcript: ENSMUST00000028487
AA Change: I305T

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000028487
Gene: ENSMUSG00000027082
AA Change: I305T

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
KU 48 101 4.4e-25 SMART
KU 119 172 7.97e-23 SMART
KU 223 276 2.25e-22 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000111718
AA Change: I305T

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000107347
Gene: ENSMUSG00000027082
AA Change: I305T

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
KU 48 101 4.4e-25 SMART
KU 119 172 7.97e-23 SMART
KU 223 276 2.25e-22 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000111722
AA Change: I299T

PolyPhen 2 Score 0.673 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000107351
Gene: ENSMUSG00000027082
AA Change: I299T

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
KU 48 101 4.4e-25 SMART
KU 119 172 7.97e-23 SMART
KU 217 270 2.25e-22 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125677
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.8%
  • 10x: 94.6%
  • 20x: 87.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a Kunitz-type serine protease inhibitor that regulates the tissue factor (TF)-dependent pathway of blood coagulation. The coagulation process initiates with the formation of a factor VIIa-TF complex, which proteolytically activates additional proteases (factors IX and X) and ultimately leads to the formation of a fibrin clot. The product of this gene inhibits the activated factor X and VIIa-TF proteases in an autoregulatory loop. Inhibition of the encoded protein restores hemostasis in animal models of hemophilia. This gene encodes multiple protein isoforms that differ in their inhibitory activity, specificity and cellular localization. [provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygous mutant embryos die showing hemorrhages of the yolk sac, central nervous system, and tail. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb3 T C 1: 25,094,183 N404S possibly damaging Het
Cep85 T C 4: 134,152,288 E383G probably damaging Het
Chst4 A T 8: 110,029,844 H379Q probably benign Het
Clca3b A T 3: 144,823,519 I798N probably damaging Het
Cldnd1 T G 16: 58,732,653 L159R possibly damaging Het
Cntnap3 T C 13: 64,758,290 E834G probably damaging Het
Col2a1 C T 15: 97,979,202 R1065Q probably damaging Het
Dchs1 T C 7: 105,765,955 D674G probably damaging Het
Dntt A G 19: 41,055,785 Y463C probably damaging Het
Egfr A G 11: 16,869,241 E257G probably benign Het
Eif4b C T 15: 102,089,901 R339* probably null Het
Fat1 C T 8: 45,023,383 T1822M probably benign Het
Fgd3 T C 13: 49,281,937 N282D probably damaging Het
Fmo4 T C 1: 162,803,700 M233V possibly damaging Het
Gabbr2 T A 4: 46,684,319 M652L probably benign Het
Gal3st2c G A 1: 94,006,928 V13M probably damaging Het
Gapvd1 C T 2: 34,709,228 G686D probably damaging Het
Gdap1l1 T G 2: 163,438,604 L20R probably damaging Het
Gm5800 A T 14: 51,714,559 M82K probably benign Het
Grm6 T A 11: 50,863,145 C759S probably damaging Het
Hs3st1 A T 5: 39,615,050 D83E probably benign Het
Il12rb1 A G 8: 70,810,606 D39G probably damaging Het
Ldhb C A 6: 142,492,598 K244N possibly damaging Het
Lypd6 C T 2: 50,190,698 R133* probably null Het
Med13l G A 5: 118,721,392 G215S probably damaging Het
Ncoa1 T C 12: 4,295,196 D606G probably damaging Het
Noc2l C T 4: 156,240,622 T151M probably damaging Het
Olfr1107 T C 2: 87,071,397 T246A probably benign Het
Olfr1395 T A 11: 49,149,189 C311S probably benign Het
Olfr1419 T C 19: 11,870,377 T280A probably damaging Het
Olfr520 T C 7: 99,735,356 L71P probably damaging Het
Olfr706 T C 7: 106,886,010 K269R probably benign Het
Ppm1l G A 3: 69,553,070 G327R probably damaging Het
Rapgef5 C T 12: 117,595,291 A282V probably benign Het
Rnf139 T C 15: 58,899,518 V464A probably damaging Het
Rprd2 C T 3: 95,764,735 E1119K probably damaging Het
Sipa1l2 G A 8: 125,492,262 T112I probably benign Het
Skint6 T C 4: 113,148,523 T363A possibly damaging Het
Slc22a16 G T 10: 40,603,815 E607* probably null Het
Slc24a2 T C 4: 86,991,411 Y690C probably damaging Het
Slc25a23 T C 17: 57,047,306 S115G probably benign Het
Slc4a3 T C 1: 75,550,891 L168P probably damaging Het
Spats2 T A 15: 99,178,452 I137N possibly damaging Het
Stard4 A T 18: 33,205,098 V133D probably damaging Het
Syn3 A G 10: 86,448,864 probably null Het
Tmtc1 T A 6: 148,412,820 probably null Het
Tpcn1 A C 5: 120,544,420 W508G probably damaging Het
Ubr5 A T 15: 38,030,730 N406K possibly damaging Het
Xrcc1 T A 7: 24,565,627 L118* probably null Het
Zbtb5 T C 4: 44,995,129 Y85C probably damaging Het
Zfand4 C A 6: 116,329,412 Y735* probably null Het
Zfp180 G T 7: 24,105,908 C584F probably damaging Het
Other mutations in Tfpi
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01484:Tfpi APN 2 84444825 nonsense probably null
IGL01860:Tfpi APN 2 84444034 missense probably benign 0.00
IGL02434:Tfpi APN 2 84452548 splice site probably benign
IGL03087:Tfpi APN 2 84444045 missense possibly damaging 0.61
I1329:Tfpi UTSW 2 84444116 missense possibly damaging 0.77
R0883:Tfpi UTSW 2 84443320 splice site probably benign
R1069:Tfpi UTSW 2 84453792 splice site probably benign
R1854:Tfpi UTSW 2 84458107 missense probably benign 0.00
R1991:Tfpi UTSW 2 84458016 splice site probably benign
R2910:Tfpi UTSW 2 84444093 missense possibly damaging 0.93
R3085:Tfpi UTSW 2 84442883 utr 3 prime probably benign
R4403:Tfpi UTSW 2 84444862 missense probably damaging 0.98
R4473:Tfpi UTSW 2 84458082 missense probably null 1.00
R4878:Tfpi UTSW 2 84452555 critical splice donor site probably null
R5810:Tfpi UTSW 2 84434424 intron probably benign
R5949:Tfpi UTSW 2 84444748 missense probably benign 0.37
R6899:Tfpi UTSW 2 84444809 missense probably damaging 1.00
R8024:Tfpi UTSW 2 84453922 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- ACAGTCAACATGATTGCTCAGGATGAAA -3'
(R):5'- ACACAAAACCTTAATGTCCTTCTGCTCC -3'

Sequencing Primer
(F):5'- GCTCAGGATGAAAGATTTTATTTCTC -3'
(R):5'- agaagaaaggagggaggagg -3'
Posted On2014-04-13