Incidental Mutation 'R1577:Gdap1l1'
ID171202
Institutional Source Beutler Lab
Gene Symbol Gdap1l1
Ensembl Gene ENSMUSG00000017943
Gene Nameganglioside-induced differentiation-associated protein 1-like 1
Synonyms
MMRRC Submission 039615-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.288) question?
Stock #R1577 (G1)
Quality Score172
Status Not validated
Chromosome2
Chromosomal Location163438476-163455324 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 163438604 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Arginine at position 20 (L20R)
Ref Sequence ENSEMBL: ENSMUSP00000119421 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018087] [ENSMUST00000109420] [ENSMUST00000109421] [ENSMUST00000137070]
Predicted Effect possibly damaging
Transcript: ENSMUST00000018087
AA Change: L20R

PolyPhen 2 Score 0.824 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000018087
Gene: ENSMUSG00000017943
AA Change: L20R

DomainStartEndE-ValueType
Pfam:GST_N 45 120 3.1e-8 PFAM
Pfam:GST_N_3 49 126 1.1e-13 PFAM
Pfam:GST_N_2 55 121 7.1e-10 PFAM
Pfam:GST_C_2 206 304 3.1e-8 PFAM
transmembrane domain 340 362 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000109420
AA Change: L20R

PolyPhen 2 Score 0.824 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000105047
Gene: ENSMUSG00000017943
AA Change: L20R

DomainStartEndE-ValueType
Pfam:GST_N 45 120 3.1e-8 PFAM
Pfam:GST_N_3 49 126 1.1e-13 PFAM
Pfam:GST_N_2 55 121 7.1e-10 PFAM
Pfam:GST_C_2 206 304 3.1e-8 PFAM
transmembrane domain 340 362 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000109421
AA Change: L20R

PolyPhen 2 Score 0.749 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000105048
Gene: ENSMUSG00000017943
AA Change: L20R

DomainStartEndE-ValueType
Pfam:GST_N 45 123 1.2e-8 PFAM
Pfam:GST_N_3 49 129 3.3e-10 PFAM
Pfam:GST_N_2 62 124 7.6e-9 PFAM
Pfam:GST_C_2 182 307 8.2e-9 PFAM
Pfam:GST_C 201 311 3.4e-8 PFAM
transmembrane domain 343 365 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000137070
AA Change: L20R

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000119421
Gene: ENSMUSG00000017943
AA Change: L20R

DomainStartEndE-ValueType
Pfam:GST_N 45 120 2.3e-8 PFAM
Pfam:GST_N_3 49 126 1.6e-13 PFAM
Pfam:GST_N_2 55 121 1.1e-9 PFAM
Pfam:GST_C_2 142 246 3.1e-8 PFAM
Pfam:GST_C 146 251 1.6e-6 PFAM
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.8%
  • 10x: 94.6%
  • 20x: 87.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The ganglioside GD3 synthase causes cell differentiation with neurite sprouting when transfected into the mouse neuroblastoma cell line Neuro2a. After differentiation, the expression of several genes is upregulated, including one that encodes a protein termed ganglioside-induced differentiation-associated protein 1 (Gdap1). A similar gene was found in humans, and mutations in the human gene are associated with Charcot-Marie-Tooth type 4A disease. The protein encoded by this gene is similar in sequence to the human GDAP1 protein. Several transcript variants encoding different isoforms, as well as a noncoding transcript variant, have been found for this gene. [provided by RefSeq, Feb 2012]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb3 T C 1: 25,094,183 N404S possibly damaging Het
Cep85 T C 4: 134,152,288 E383G probably damaging Het
Chst4 A T 8: 110,029,844 H379Q probably benign Het
Clca3b A T 3: 144,823,519 I798N probably damaging Het
Cldnd1 T G 16: 58,732,653 L159R possibly damaging Het
Cntnap3 T C 13: 64,758,290 E834G probably damaging Het
Col2a1 C T 15: 97,979,202 R1065Q probably damaging Het
Dchs1 T C 7: 105,765,955 D674G probably damaging Het
Dntt A G 19: 41,055,785 Y463C probably damaging Het
Egfr A G 11: 16,869,241 E257G probably benign Het
Eif4b C T 15: 102,089,901 R339* probably null Het
Fat1 C T 8: 45,023,383 T1822M probably benign Het
Fgd3 T C 13: 49,281,937 N282D probably damaging Het
Fmo4 T C 1: 162,803,700 M233V possibly damaging Het
Gabbr2 T A 4: 46,684,319 M652L probably benign Het
Gal3st2c G A 1: 94,006,928 V13M probably damaging Het
Gapvd1 C T 2: 34,709,228 G686D probably damaging Het
Gm5800 A T 14: 51,714,559 M82K probably benign Het
Grm6 T A 11: 50,863,145 C759S probably damaging Het
Hs3st1 A T 5: 39,615,050 D83E probably benign Het
Il12rb1 A G 8: 70,810,606 D39G probably damaging Het
Ldhb C A 6: 142,492,598 K244N possibly damaging Het
Lypd6 C T 2: 50,190,698 R133* probably null Het
Med13l G A 5: 118,721,392 G215S probably damaging Het
Ncoa1 T C 12: 4,295,196 D606G probably damaging Het
Noc2l C T 4: 156,240,622 T151M probably damaging Het
Olfr1107 T C 2: 87,071,397 T246A probably benign Het
Olfr1395 T A 11: 49,149,189 C311S probably benign Het
Olfr1419 T C 19: 11,870,377 T280A probably damaging Het
Olfr520 T C 7: 99,735,356 L71P probably damaging Het
Olfr706 T C 7: 106,886,010 K269R probably benign Het
Ppm1l G A 3: 69,553,070 G327R probably damaging Het
Rapgef5 C T 12: 117,595,291 A282V probably benign Het
Rnf139 T C 15: 58,899,518 V464A probably damaging Het
Rprd2 C T 3: 95,764,735 E1119K probably damaging Het
Sipa1l2 G A 8: 125,492,262 T112I probably benign Het
Skint6 T C 4: 113,148,523 T363A possibly damaging Het
Slc22a16 G T 10: 40,603,815 E607* probably null Het
Slc24a2 T C 4: 86,991,411 Y690C probably damaging Het
Slc25a23 T C 17: 57,047,306 S115G probably benign Het
Slc4a3 T C 1: 75,550,891 L168P probably damaging Het
Spats2 T A 15: 99,178,452 I137N possibly damaging Het
Stard4 A T 18: 33,205,098 V133D probably damaging Het
Syn3 A G 10: 86,448,864 probably null Het
Tfpi A G 2: 84,433,103 I305T probably damaging Het
Tmtc1 T A 6: 148,412,820 probably null Het
Tpcn1 A C 5: 120,544,420 W508G probably damaging Het
Ubr5 A T 15: 38,030,730 N406K possibly damaging Het
Xrcc1 T A 7: 24,565,627 L118* probably null Het
Zbtb5 T C 4: 44,995,129 Y85C probably damaging Het
Zfand4 C A 6: 116,329,412 Y735* probably null Het
Zfp180 G T 7: 24,105,908 C584F probably damaging Het
Other mutations in Gdap1l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02119:Gdap1l1 APN 2 163453668 missense probably damaging 1.00
IGL02171:Gdap1l1 APN 2 163447550 missense possibly damaging 0.78
IGL02335:Gdap1l1 APN 2 163447595 missense possibly damaging 0.50
F5770:Gdap1l1 UTSW 2 163447486 intron probably benign
R0091:Gdap1l1 UTSW 2 163446091 missense probably damaging 1.00
R0165:Gdap1l1 UTSW 2 163451499 critical splice acceptor site probably null
R0242:Gdap1l1 UTSW 2 163447653 nonsense probably null
R2022:Gdap1l1 UTSW 2 163447597 missense probably benign 0.04
R4960:Gdap1l1 UTSW 2 163453859 missense probably benign 0.00
R6027:Gdap1l1 UTSW 2 163451611 missense possibly damaging 0.57
R6292:Gdap1l1 UTSW 2 163451507 missense probably damaging 1.00
R6678:Gdap1l1 UTSW 2 163438654 missense probably benign
R7034:Gdap1l1 UTSW 2 163446145 missense probably damaging 1.00
R7173:Gdap1l1 UTSW 2 163438688 missense probably damaging 0.99
R7195:Gdap1l1 UTSW 2 163446130 missense probably damaging 1.00
Z1176:Gdap1l1 UTSW 2 163447670 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CCTGCACCCAGTGAGTAATGACATC -3'
(R):5'- TGAAGAAGACCCCTGCTAGAACGAG -3'

Sequencing Primer
(F):5'- TGAGTAATGACATCGCGGG -3'
(R):5'- AAGGAGATGCTCCTGGCATTG -3'
Posted On2014-04-13