Incidental Mutation 'R1577:Ppm1l'
ID171204
Institutional Source Beutler Lab
Gene Symbol Ppm1l
Ensembl Gene ENSMUSG00000027784
Gene Nameprotein phosphatase 1 (formerly 2C)-like
Synonyms5930404J21Rik, Pp2ce, PP2C-epsilon
MMRRC Submission 039615-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.209) question?
Stock #R1577 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location69316861-69560802 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 69553070 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Arginine at position 327 (G327R)
Ref Sequence ENSEMBL: ENSMUSP00000029355 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029355]
Predicted Effect probably damaging
Transcript: ENSMUST00000029355
AA Change: G327R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000029355
Gene: ENSMUSG00000027784
AA Change: G327R

DomainStartEndE-ValueType
PP2Cc 77 349 3.17e-75 SMART
PP2C_SIG 103 351 1.28e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128637
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134037
SMART Domains Protein: ENSMUSP00000120467
Gene: ENSMUSG00000027784

DomainStartEndE-ValueType
PP2Cc 3 106 6.3e-2 SMART
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.8%
  • 10x: 94.6%
  • 20x: 87.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a magnesium or manganese-requiring phosphatase that is involved in several signaling pathways. The encoded protein downregulates apoptosis signal-regulating kinase 1, a protein that initiates a signaling cascade that leads to apoptosis when cells are subjected to cytotoxic stresses. This protein also is an endoplasmic reticulum transmembrane protein that helps regulate ceramide transport from the endoplasmic reticulum to the Golgi apparatus. Finally, this gene may be involved in adiposity since it is upregulated in adipose tissues. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2015]
PHENOTYPE: Homozygotes for a null allele show increased body weight and total fat mass, higher blood pressure and plasma glucose levels, lower free fatty acid levels and improved glucose tolerance. Homozygotes for another null allele show postnatal lethality, motor deficits and altered forebrain morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb3 T C 1: 25,094,183 N404S possibly damaging Het
Cep85 T C 4: 134,152,288 E383G probably damaging Het
Chst4 A T 8: 110,029,844 H379Q probably benign Het
Clca3b A T 3: 144,823,519 I798N probably damaging Het
Cldnd1 T G 16: 58,732,653 L159R possibly damaging Het
Cntnap3 T C 13: 64,758,290 E834G probably damaging Het
Col2a1 C T 15: 97,979,202 R1065Q probably damaging Het
Dchs1 T C 7: 105,765,955 D674G probably damaging Het
Dntt A G 19: 41,055,785 Y463C probably damaging Het
Egfr A G 11: 16,869,241 E257G probably benign Het
Eif4b C T 15: 102,089,901 R339* probably null Het
Fat1 C T 8: 45,023,383 T1822M probably benign Het
Fgd3 T C 13: 49,281,937 N282D probably damaging Het
Fmo4 T C 1: 162,803,700 M233V possibly damaging Het
Gabbr2 T A 4: 46,684,319 M652L probably benign Het
Gal3st2c G A 1: 94,006,928 V13M probably damaging Het
Gapvd1 C T 2: 34,709,228 G686D probably damaging Het
Gdap1l1 T G 2: 163,438,604 L20R probably damaging Het
Gm5800 A T 14: 51,714,559 M82K probably benign Het
Grm6 T A 11: 50,863,145 C759S probably damaging Het
Hs3st1 A T 5: 39,615,050 D83E probably benign Het
Il12rb1 A G 8: 70,810,606 D39G probably damaging Het
Ldhb C A 6: 142,492,598 K244N possibly damaging Het
Lypd6 C T 2: 50,190,698 R133* probably null Het
Med13l G A 5: 118,721,392 G215S probably damaging Het
Ncoa1 T C 12: 4,295,196 D606G probably damaging Het
Noc2l C T 4: 156,240,622 T151M probably damaging Het
Olfr1107 T C 2: 87,071,397 T246A probably benign Het
Olfr1395 T A 11: 49,149,189 C311S probably benign Het
Olfr1419 T C 19: 11,870,377 T280A probably damaging Het
Olfr520 T C 7: 99,735,356 L71P probably damaging Het
Olfr706 T C 7: 106,886,010 K269R probably benign Het
Rapgef5 C T 12: 117,595,291 A282V probably benign Het
Rnf139 T C 15: 58,899,518 V464A probably damaging Het
Rprd2 C T 3: 95,764,735 E1119K probably damaging Het
Sipa1l2 G A 8: 125,492,262 T112I probably benign Het
Skint6 T C 4: 113,148,523 T363A possibly damaging Het
Slc22a16 G T 10: 40,603,815 E607* probably null Het
Slc24a2 T C 4: 86,991,411 Y690C probably damaging Het
Slc25a23 T C 17: 57,047,306 S115G probably benign Het
Slc4a3 T C 1: 75,550,891 L168P probably damaging Het
Spats2 T A 15: 99,178,452 I137N possibly damaging Het
Stard4 A T 18: 33,205,098 V133D probably damaging Het
Syn3 A G 10: 86,448,864 probably null Het
Tfpi A G 2: 84,433,103 I305T probably damaging Het
Tmtc1 T A 6: 148,412,820 probably null Het
Tpcn1 A C 5: 120,544,420 W508G probably damaging Het
Ubr5 A T 15: 38,030,730 N406K possibly damaging Het
Xrcc1 T A 7: 24,565,627 L118* probably null Het
Zbtb5 T C 4: 44,995,129 Y85C probably damaging Het
Zfand4 C A 6: 116,329,412 Y735* probably null Het
Zfp180 G T 7: 24,105,908 C584F probably damaging Het
Other mutations in Ppm1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00863:Ppm1l APN 3 69317950 missense probably damaging 1.00
IGL02834:Ppm1l APN 3 69549343 missense probably damaging 1.00
R0270:Ppm1l UTSW 3 69317976 splice site probably benign
R0310:Ppm1l UTSW 3 69549461 missense probably benign 0.39
R0557:Ppm1l UTSW 3 69497901 missense probably benign 0.39
R3508:Ppm1l UTSW 3 69549480 missense possibly damaging 0.81
R4750:Ppm1l UTSW 3 69549328 missense probably damaging 0.99
R4864:Ppm1l UTSW 3 69542511 intron probably benign
R5007:Ppm1l UTSW 3 69317598 missense probably damaging 1.00
R5406:Ppm1l UTSW 3 69317594 missense possibly damaging 0.66
R6168:Ppm1l UTSW 3 69549407 missense probably damaging 1.00
R6256:Ppm1l UTSW 3 69497897 missense probably benign
R6474:Ppm1l UTSW 3 69553041 missense probably damaging 0.99
R6517:Ppm1l UTSW 3 69317583 missense probably damaging 0.98
R6949:Ppm1l UTSW 3 69549403 missense possibly damaging 0.90
R7029:Ppm1l UTSW 3 69553066 missense probably benign 0.16
R7086:Ppm1l UTSW 3 69317853 missense probably damaging 1.00
R7312:Ppm1l UTSW 3 69317711 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- AGCTTGTGGTACACTCACCCAGAC -3'
(R):5'- CTCCAAAGGGATTCAAGGCCATCAG -3'

Sequencing Primer
(F):5'- ATCCCTGGGAGACTATCCACTG -3'
(R):5'- GGGACGCATGATCCTAATTATACC -3'
Posted On2014-04-13