Incidental Mutation 'R1577:Cep85'
ID171212
Institutional Source Beutler Lab
Gene Symbol Cep85
Ensembl Gene ENSMUSG00000037443
Gene Namecentrosomal protein 85
Synonyms2410030J07Rik, Ccdc21
MMRRC Submission 039615-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.955) question?
Stock #R1577 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location134129858-134187112 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 134152288 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 383 (E383G)
Ref Sequence ENSEMBL: ENSMUSP00000113351 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040271] [ENSMUST00000121566] [ENSMUST00000137388]
Predicted Effect probably damaging
Transcript: ENSMUST00000040271
AA Change: E385G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000039889
Gene: ENSMUSG00000037443
AA Change: E385G

DomainStartEndE-ValueType
coiled coil region 333 656 N/A INTRINSIC
coiled coil region 725 749 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000121566
AA Change: E383G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113351
Gene: ENSMUSG00000037443
AA Change: E383G

DomainStartEndE-ValueType
coiled coil region 331 654 N/A INTRINSIC
coiled coil region 723 747 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000137388
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141992
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145531
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.8%
  • 10x: 94.6%
  • 20x: 87.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the centrosome-associated family of proteins. The centrosome is a subcellular organelle in the animal cell that functions as a microtubule organizing center and is involved in cell-cycle progression. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb3 T C 1: 25,094,183 N404S possibly damaging Het
Chst4 A T 8: 110,029,844 H379Q probably benign Het
Clca3b A T 3: 144,823,519 I798N probably damaging Het
Cldnd1 T G 16: 58,732,653 L159R possibly damaging Het
Cntnap3 T C 13: 64,758,290 E834G probably damaging Het
Col2a1 C T 15: 97,979,202 R1065Q probably damaging Het
Dchs1 T C 7: 105,765,955 D674G probably damaging Het
Dntt A G 19: 41,055,785 Y463C probably damaging Het
Egfr A G 11: 16,869,241 E257G probably benign Het
Eif4b C T 15: 102,089,901 R339* probably null Het
Fat1 C T 8: 45,023,383 T1822M probably benign Het
Fgd3 T C 13: 49,281,937 N282D probably damaging Het
Fmo4 T C 1: 162,803,700 M233V possibly damaging Het
Gabbr2 T A 4: 46,684,319 M652L probably benign Het
Gal3st2c G A 1: 94,006,928 V13M probably damaging Het
Gapvd1 C T 2: 34,709,228 G686D probably damaging Het
Gdap1l1 T G 2: 163,438,604 L20R probably damaging Het
Gm5800 A T 14: 51,714,559 M82K probably benign Het
Grm6 T A 11: 50,863,145 C759S probably damaging Het
Hs3st1 A T 5: 39,615,050 D83E probably benign Het
Il12rb1 A G 8: 70,810,606 D39G probably damaging Het
Ldhb C A 6: 142,492,598 K244N possibly damaging Het
Lypd6 C T 2: 50,190,698 R133* probably null Het
Med13l G A 5: 118,721,392 G215S probably damaging Het
Ncoa1 T C 12: 4,295,196 D606G probably damaging Het
Noc2l C T 4: 156,240,622 T151M probably damaging Het
Olfr1107 T C 2: 87,071,397 T246A probably benign Het
Olfr1395 T A 11: 49,149,189 C311S probably benign Het
Olfr1419 T C 19: 11,870,377 T280A probably damaging Het
Olfr520 T C 7: 99,735,356 L71P probably damaging Het
Olfr706 T C 7: 106,886,010 K269R probably benign Het
Ppm1l G A 3: 69,553,070 G327R probably damaging Het
Rapgef5 C T 12: 117,595,291 A282V probably benign Het
Rnf139 T C 15: 58,899,518 V464A probably damaging Het
Rprd2 C T 3: 95,764,735 E1119K probably damaging Het
Sipa1l2 G A 8: 125,492,262 T112I probably benign Het
Skint6 T C 4: 113,148,523 T363A possibly damaging Het
Slc22a16 G T 10: 40,603,815 E607* probably null Het
Slc24a2 T C 4: 86,991,411 Y690C probably damaging Het
Slc25a23 T C 17: 57,047,306 S115G probably benign Het
Slc4a3 T C 1: 75,550,891 L168P probably damaging Het
Spats2 T A 15: 99,178,452 I137N possibly damaging Het
Stard4 A T 18: 33,205,098 V133D probably damaging Het
Syn3 A G 10: 86,448,864 probably null Het
Tfpi A G 2: 84,433,103 I305T probably damaging Het
Tmtc1 T A 6: 148,412,820 probably null Het
Tpcn1 A C 5: 120,544,420 W508G probably damaging Het
Ubr5 A T 15: 38,030,730 N406K possibly damaging Het
Xrcc1 T A 7: 24,565,627 L118* probably null Het
Zbtb5 T C 4: 44,995,129 Y85C probably damaging Het
Zfand4 C A 6: 116,329,412 Y735* probably null Het
Zfp180 G T 7: 24,105,908 C584F probably damaging Het
Other mutations in Cep85
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01113:Cep85 APN 4 134148761 missense possibly damaging 0.63
IGL01397:Cep85 APN 4 134156206 missense probably damaging 1.00
IGL01472:Cep85 APN 4 134134166 missense possibly damaging 0.55
IGL01522:Cep85 APN 4 134152255 missense probably damaging 1.00
IGL01522:Cep85 APN 4 134152256 missense probably damaging 1.00
IGL02004:Cep85 APN 4 134167387 missense probably damaging 1.00
IGL02043:Cep85 APN 4 134155727 missense probably benign 0.02
IGL02187:Cep85 APN 4 134131305 missense possibly damaging 0.86
IGL02317:Cep85 APN 4 134155811 missense probably damaging 1.00
IGL02543:Cep85 APN 4 134156323 missense possibly damaging 0.52
1mM(1):Cep85 UTSW 4 134156264 missense possibly damaging 0.88
PIT4468001:Cep85 UTSW 4 134148697 missense probably damaging 1.00
R0060:Cep85 UTSW 4 134167300 missense probably damaging 1.00
R0068:Cep85 UTSW 4 134154295 missense probably benign 0.00
R0346:Cep85 UTSW 4 134132422 missense probably damaging 1.00
R0462:Cep85 UTSW 4 134131421 missense possibly damaging 0.88
R1295:Cep85 UTSW 4 134167400 missense probably damaging 1.00
R1296:Cep85 UTSW 4 134167400 missense probably damaging 1.00
R1472:Cep85 UTSW 4 134167400 missense probably damaging 1.00
R1681:Cep85 UTSW 4 134148728 nonsense probably null
R1687:Cep85 UTSW 4 134148013 missense probably benign 0.00
R2031:Cep85 UTSW 4 134132450 missense probably benign 0.00
R2216:Cep85 UTSW 4 134131430 missense possibly damaging 0.62
R2220:Cep85 UTSW 4 134153867 missense probably damaging 1.00
R4321:Cep85 UTSW 4 134132285 missense probably damaging 1.00
R4888:Cep85 UTSW 4 134164751 intron probably benign
R5044:Cep85 UTSW 4 134156179 missense probably damaging 0.97
R5075:Cep85 UTSW 4 134132367 missense probably damaging 1.00
R5627:Cep85 UTSW 4 134134097 missense probably damaging 1.00
R6841:Cep85 UTSW 4 134155856 missense probably benign
R6842:Cep85 UTSW 4 134155856 missense probably benign
R6843:Cep85 UTSW 4 134155856 missense probably benign
R6981:Cep85 UTSW 4 134152261 missense probably damaging 1.00
R7252:Cep85 UTSW 4 134148031 missense probably benign 0.12
R7869:Cep85 UTSW 4 134132298 missense probably damaging 0.99
R8057:Cep85 UTSW 4 134153614 unclassified probably benign
R8194:Cep85 UTSW 4 134134089 missense probably null 0.00
V8831:Cep85 UTSW 4 134156069 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- TCCTCCGAATGCTTCTGTAGTGTCA -3'
(R):5'- AGGAAAGGGAGTCAACCTGAGTCTT -3'

Sequencing Primer
(F):5'- CACTTTTAGAGACTCCCTAATGAGC -3'
(R):5'- agccatctctccagccc -3'
Posted On2014-04-13